Микоплазмоз у щенка: Микоплазмоз у собак: причины, диагностика, лечение, профидактика

Содержание

МИКОПЛАЗМОЗ общий и патогенный — сеть ветеринарных лабораторий «Шанс Био»

Микоплазмы – это группа одноклеточных микроорганизмов, занимающих промежуточное место между вирусами и бактериями.

Виды воздействия микоплазм на макроорганизм: микоплазма способна подавлять рост и развитие клеток, иммунной системы хозяина. Таким образом, на фоне микоплазмоза снижается иммунитет организма в целом. Кроме того, вступая во взаимодействие с клетками организма хозяина, микоплазма нарушает процесс распознавания антигенов (чужеродных организму веществ, клеток) и начинается выработка антител (белки плазмы крови, обладающие способностью нейтрализовывать действие чужеродных микробов, вирусов, токсинов) против собственных клеток. Этот процесс называется аутоиммунным.

Источником микоплазменной инфекции служат инфицированные животные, заражение микоплазмами происходит при прямом контакте животного с источником инфекции в основном половым и аэрозольным путями.

Плоды могут заражаться внутриутробно.

Существует две основные разновидности микоплазменной инфекции: респираторный микоплазмоз (поражение дыхательных путей) и урогенитальная инфекция (поражение мочеполовых и репродуктивных органов). Также микоплазмоз может давать осложнения при заболеваниях опорно-двигательного аппарата.

Микоплазмозы вызывают различные симптомы заболевания: рецидивирующие вагиниты, баланопоститы, уретриты, простатиты, орхоэпидидимиты, отек мошонки, снижение фертильности – у самцов. При тяжелых микоплазмозах возможно рассасывание эмбрионов, абортирование, потомство рождаются недоразвитыми, наблюдается высокая неонатальная смертность в первые дни.

При респираторной форме заболевания отмечаются следующие симптомы: чихание, слюнотечение, кашель (глубокий, сухой или влажный), выделения из глаз и носа, лихорадка, затрудненное дыхание (одышка), сонливость, усталость, потеря аппетита (отсутствие аппетита, анорексия) и потеря веса.

При снижении иммунитета животного, возникающем на фоне заболеваний другой этиологии, в период щенности, при воздействии стресс-факторов (выставки, вязки, гостиницы) болезнь обостряется, сопровождаясь развитием в тканях патоморфологических повреждений.

Установлено, что инфекция распространена как в больших колониях животных (кошек и собак), так и среди животных домашнего содержания, причем микроорганизм выделен как от больных, так и от здоровых животных.

По данным лаборатории «Шанс Био» количество положительных проб на микоплазмоз среди других видов животных (крыс, кроликов, морских свинок) достигает 85%.

КОШКИ:

По данным зарубежной литературы частота выявления микоплазм различных видов на слизистых оболочках клинически здоровых кошек достигает 70%.

От кошек выделены следующие микоплазмы: 

M. felis, M. gatae, M. feliminutum, M. arginine, M. pulmonis, M.arthritidis, M. allisepticum.

М. gatae является естественным комменсалом конъюнктивы и верхних дыхательных путей кошек и, возможно, в этих местах имеет небольшой патогенный потенциал. При конъюнктивите и болезнях верхних дыхательных путей патогенная роль отводится – M. felis.

По данным лаборатории «Шанс био» — 35% от общего числа обследованных кошек были положительными по Mycoрlasma sр..

На данный момент количество положительных кошек по микоплазмозу увеличилось примерно на 10%, и составило около 45% от общего количества исследованных кошек.

СОБАКИ:

Микоплазмы, вызывающие заболевания органов дыхания и репродуктивных органов у собак: М. вovigenitalium, М. сanis, М. сynos, М. еdwardii, М. feliminutum, М. gatea, М. spumans M. maculosum, M. opalescens, M. molare, M. arginini.

По литературным данным 30-35 % здоровых собак содержат микоплазму в органах дыхательной системы

Основным возбудителем респираторных микоплазменных инфекций является Mycoplasma сynos.  Выделяется с конъюнктивы, миндалин, а также воздуха питомников. Сохраняется в легких в течение 3 недель после заражения, являясь источником инфекции для других животных.

М. сanis в основном в составе смешанных инфекций вызывают различные симптомы урогенитальной сферы: эндометриты, баланопоститы, уретриты, простатиты, орхоэпидидимиты, отек мошонки, а в сочетании с инфекцией Ureaplasma снижение фертильности – у самцов.

По данным лаборатории «Шанс Био» — 60 % собак были положительные по Mycoрlasma sр., от общего количества обследованных животных.

На данный момент количество положительных собак по микоплазмозу остается на прежнем уровне 55 – 60%.

Микоплазмы, относящиеся к непатогенным микоплазмам могут играть роль секундарной инфекции при других заболеваниях, которые вызывают ослабление иммунитета, при хронических воспалительных процессах, при различных стресс факторах.

МАТЕРИАЛОМ ДЛЯ ИССЛЕДОВАНИЯ НА МИКОПЛАЗМОЗ В ЗАВИСИМОСТИ ОТ КЛИНИЧЕСКОЙ КАРТИНЫ СЛУЖАТ:

При урогенитальной инфекции: смывы из петли/препуция, сперма, абортированный плод, плацента, околоплодная жидкость.

При респираторной форме заболевания: смывы со слизистых оболочек носа, глаз и зева. У собак для постановки окончательного диагноза, в связи с наличием в норме популяции микоплазм на слизистых конъюнктивы и носовых ходов, рекомендуется брать трахеобронхиальный лаваж (данная процедура в лаборатории не проводится, а осуществляется ветеринарным врачом по месту лечения).

При посмертной диагностике – фрагменты легочной ткани.

На сегодняшний день лаборатория «Шанс Био» первая из лабораторий предлагает дифференциальную диагностику патогенных видов микоплазм собак и кошек.

Исследование позволяет дифференцировать патогенные виды микоплазм от Mycoрlasma sр., для собак к патогенным относят – М. сanis, М. сynos, а для кошек – M. felis, M. gatae.

По данным лаборатории «Шанс Био» при исследовании положительных проб по Mycoрlasma sр., на патогенные виды микоплазм положительными у собак было 50% проб, а у кошек 15%.

Мониторинг лечения: по окончании курса лечения обязательно проведение контрольных исследований для определения его эффективности. По данным лаборатории «Шанс Био» после лечения повторный анализ на микоплазмоз следует проводить не раньше, чем через 6-8 недель по окончании курса лечения.

Микоплазмоз у собак — симптомы, диагностика, лечение

Содержание
  1. Симптомы
  2. Диагностика
  3. Лечение
  4. Профилактика

Микоплазмоз – группа заболеваний, которые вызывает условно-патогенный микроорганизм класса Mollicutes. Микоплазмы не имеют клеточной стенки, способны жить даже при полном отсутствии кислорода и являются наиболее простыми самостоятельно воспроизводящимися живыми организмами.

Эти бактерии распространены повсеместно в природе, могут вызывать заболевания не только у собак, но и у людей, кошек, растений и насекомых.

Микоплазмы являются условно патогенными микроорганизмами. Это значит, что они могут в норме присутствовать в слизистых оболочках собак, при этом не вызывая заболевания. Однако микоплазмоз у собак часто развивается на фоне общего ослабления иммунитета, под влиянием стрессов, опухолевых процессов, хронических вирусных инфекций.

Симптомы
  1. Конъюнктивиты. Чаще всего микоплазмы поражают глаза, конъюнктива глаза становится красной и воспаленной, у собаки текут слезы. В более редких случаях болезнь характеризуется поражением роговицы.
  2. Респираторные инфекции. При микоплазмозе возможен ринит, сухой кашель, чихание. Помимо вышеперечисленного у собаки может развиться лихорадка.
  3. Инфекции мочеполовой системы. Существует мнение, что микоплазмы могут вызывать у сук вагиниты, малоплодие, раннюю гибель эмбрионов, аборты, раннюю смертность щенков. Однако доказательств такого патогенеза этих нарушений пока носят косвенный характер. Микоплазма может являться причиной бесплодия сук, но только в том случае, если при посеве из влагалища суки данные микроорганизмы обнаруживаются в чистой или почти чистой культуре.

Тем не менее, микоплазмы могут вызывать циститы, уретриты, нефриты   и простатиты.

  1. Скелетно-мышечные инфекции: проявляются хромотой, скованностью движений, общие симптомы недомогания.
  2. Кожные заболевания: часто микоплазмы приводят к появлению абсцессов, дерматитов.
  3. Общие симптомы: лихорадка, повышение жажды, снижение или отсутствие аппетита, симптомы со стороны желудочно-кишечного тракта (диарея, рвота).
Диагностика

Все признаки данного заболевания неспецифические и похожи на проявления многих других заболеваний. Диагноз ставится на основании жалоб владельца собаки, общего осмотра и дополнительных исследований. Врачу могут понадобиться общий и биохимический анализы крови, анализ мочи.

Для того чтобы подтвердить поражение различных систем органов микоплазмой, необходимо сдать на посев простатический секрет, мочу при поражении мочеполовой системы, синовиальную жидкость при полиартрите; провести бронхо-альвеолярный лаваж при поражении легких.

Лечение

Лечение проводится амбулаторно. Как правило, основное лечение данного заболевания – антибиотикотерапия. При правильном подходе к лечению, животные со здоровым иммунитетом обычно быстро выздоравливают

Профилактика

Так как вакцин от микоплазмоза не существует, профилактика данного заболевания сводится к избеганию стрессов, а также к исключению контактов собаки с не вакцинированными, бродячими животными.

ветеринарным врачом-терапевтом «МЕДВЕТ»
© 2018 СВЦ «МЕДВЕТ»

Микоплазмоз у собак

Микоплазмозы животных — группа инфекционных заболеваний, вызываемых микроорганизмами из класса Mollicutes.  Это самые мелкие (0,2-0,3 мкм) и наиболее просто устроенные прокариоты, требовательные к питательным средам, грамотрицательные, факультативно анаэробные. В природе встречаются повсеместно в качестве сапрофитов, комменсалов и паразитов растений и животных, некоторые из них являются условно-патогенными  для человека. Микоплазмы могут быть выделены со слизистых оболочек здоровых кошек, до 80% кошек могут быть носителями.

Класс Mollicutes включает около 80 родов и подразделяется на 3 семейства: микоплазмы, уреаплазмы (микоплазмы) и ахолеплазмы. Это самые мелкие (0,2-0,3 мкм) и наиболее просто устроенные прокариоты, требовательные к питательным средам, грамотрицательные, факультативно анаэробные.

Отсутствие клеточной оболочки обусловливает их пластичность, плеоморфность, чувствительность к резким осмотическим изменениям, детергентам, спиртам, специфическим антителам и комплементу. В природе встречаются повсеместно в качестве сапрофитов, комменсалов и паразитов растений и животных, некоторые из них условно-патогенны для человека. Микоплазмы могут быть выделены со слизистых оболочек здоровых кошек и достигать такое носительство может 80%.

Тропность микоплазм весьма вариабельна. Микоплазмы вызывают респираторные болезни собак — пневмонию и заболевания верхних дыхательных путей, а также мочеполовой системы (баланопостит, уретрит, простатит, цистит, нефрит, вагинит, эндометрит) и опорно-двигательного аппарата. Микоплазмы и уреаплазмы могут быть связаны с бесплодием самок, самопроизвольными абортами, рождением ослабленных или мертвых щенков, смертностью новорожденных, а также поражением ЖКТ. Болезни кошек аналогичны: конъюнктивит, пневмония, хронический фибринозно-гнойный полиартрит и тендосиновит, заболевания мочевых путей, самопроизвольные аборты, а также хронические абсцессы кожи.

Часто при заражении микоплазмозом наблюдается наслаивание вторичной бактериальной инфекции. Микоплазмы хорошо защищены от антител и антимикробных препаратов особенностями патогенеза воспаления, что способствует переходу процесса в хроническую форму. Микоплазмы могут внедрять антиген клетки хозяина в свою плазмалемму, а белковый антиген микоплазм может включаться в плазмалемму клетки хозяина, в результате чего нарушается механизм иммунной защиты, что делает лечение очень проблематичным.

Микоплазмы часто входят в состав постоянной флоры слизистых оболочек верхних дыхательных путей, ЖКТ и половых путей и могут представлять собой оппортунистические организмы, вызывая системную инфекцию только при иммунодефиците, иммуносупрессии или онкологических заболеваниях. Микоплазмы плотно прилегают к плазмалемме клетки хозяина и получают из нее питательные вещества и ростовые факторы, в том числе нуклеотиды. Метаболиты микоплазм, в том числе перекись водорода и аммиак, могут оказывать цитопатическое действие и вызывать повреждение тканей, что и обусловливает развитие нарушения функции, пораженной ткани.

Диагноз

Часто выявляется хроническая хромота то на одну, то на другую конечность, нежелание двигаться, боли в суставах и в мышцах, повышение температуры, общее недомогание.

Во время физикального исследования обнаруживают отеки конечностей, опухание суставов, боли при пальпации, конъюнктивит (блефароспазм, хемоз, гиперемия конъюнктивы, эпифора, серозное или гнойное отделяемое), умеренный ринит (чиханье).

Дифференциальная диагностика. Болезнь дифференцируют с несколькими группами патологических процессов: инфекциями верхних дыхательных путей кошек и собак, инфекциями мочевых путей кошек и собак, болезнями половой системы собак, эндокринопатиями (недостаток прогестерона, гипотиреоидизм), артритом кошек и собак и конъюнктивитом кошек.

В общем анализе крови отмечается слабовыраженная анемия, нейтрофильный лейкоцитоз. В биохимическом анализе крови гипоальбуминемия, гипоглобулинемия. Анализ мочи может выявить протеинурию.

Используют также серологические методы (реакция связывания комплемента, иммунодиффузия в агаровом геле, твердофазный иммуноферментный анализ, реакция иммунофлюоресценции).

Для микроскопического исследования рекомендуется окрашивание мазков по Романовскому-Гимзе. Возбудитель чрезвычайно полиморфен и может быть представлен коккобациллами, кокками, кольцевидной, спиралевидной и нитевидной формами.

Диагностика сильно затруднена еще и из-за схожести клинических признаков с другими заболеваниями. Диагностика методом ПЦР позволяет избежать этих затруднений.

Лечение

Лечение длительное. Микоплазмы чувствительны к антибиотикам, специфически ингибирующим синтез у прокариотов (тетрациюшны, доксициклин, левомщетин) и устойчивы к сульфаниламидам и бета-лактамам. Можно также использовать аминогликозиды, тилозин, эритромицин, производные нитрофурана и фторхинолоны. При конъюнктивите антибиотики назначают также местно. Мази, содержащие стероиды, противопоказаны. Тетрациюшны не рекомендуется назначать щенкам, а беременным животным не назначают также и левомицетин.

Микоплазмоз у собак и кошек

Микоплазмозы — группа инфекционных болезней человека и животных, вызываемых микроорганизмами из класса Mollicutes. Заболевание характеризуется преимущественно подострым и хроническим течением, с поражением слизистых оболочек (глаз, верхних дыхательных путей, урогенитального тракта), а также опорно-двигательного аппарата и кожи. 

Возбудители микоплазмоза — это самые мелкие (0,2-0,3 мкм) и наиболее просто устроенные прокариоты, требовательные к питательным средам, грамотрицательные, факультативно анаэробные.

Микоплазмы чрезвычайно полиморфные микроорганизмы. В мазках, приготовленных из органов и культур, обнаруживаются округлые, кольцевидные, овальные, кокковидные и нитевидные образования. Клетки имеют различную величину, которая может варьировать от 125 до 600 нм.

Класс  Mollicutes (лат.: mollis — «мягкий»; cutis — «кожа») включает более 80 родов; три семейства: микоплазма (Micoplasma), уреаплазма (Ureaplasma), и ахолеплазма (Acholeplasma). 

Заражение микоплазмозом может происходить различными путями: респираторным, алиментарным, половым, контактным. Попав в организм, возбудитель прикрепляется к мембранам клеток, «сливается» с ними, и начинает размножаться. В основе патогенетического действия этих микроорганизмов лежат их уникальные свойства мембранных паразитов. Заканчивается этот процесс либо откреплением микоплазм от клетки, либо поглощением их клеткой вследствие фагоцитоза.

В составе фагоцитирующих клеток микоплазмы из первичного очага поражения могут попадать в другие органы, а также длительно персистировать в организме. Токсинов микоплазмы не выделяют, их повреждающее действие на пораженные клетки реализуется через слаботоксичные продукты обмена, такие как ионы аммония или перекись водорода, которые оказывают неблагоприятное действие на мембраны пораженных клеток только в силу тесного контакта с этими микроорганизмами. Подобный характер мембранного и внутриклеточного паразитирования приводит нередко к хроническому или латентному течению микоплазмоза, а антигенная изменчивость, присущая возбудителю, создает для этого дополнительные условия.

В патогенезе микоплазмоза определенную роль играет способность микоплазм стимулировать пролиферацию окружающих их клеток макроорганизма. Благодаря этому они могут способствовать непрямому повреждению тканей, вызывая усиление клеточных иммунных реакций (ГЗТ), а также повышая чувствительность клеток к вирусам, т.к. многие вирусы интенсивно размножаются именно в делящихся клетках.

Некоторые виды микоплазм являются частью сапрофитной микрофлоры, постоянно обитающей на слизистых оболочках ротовой полости,  верхних дыхательных путей, желудочно-кишечного и урогенитального трактов человека и животных. Например, M. gatae является комменсалом слизистой оболочки глаз и верхних дыхательных путей кошек. Человек может быть естественным резервуаром, как минимум, для 17 видов микоплазм. Более 30 видов микоплазм являются возбудителями различных заболеваний. 

Клиническое течение и выраженность симптомов микоплазмоза зависит от вида возбудителя и иммунорезистентности организма.

У иммунореактивных животных микоплазмоз протекает бессимптомно. Такие особи являются скрытыми носителями, выделяют возбудителя во внешнюю среду и являются источником инфекции для других животных.

Нередки сочетания микоплазмоза с респираторными вирусными инфекциями. Условно-патогенные микоплазмы могут вызывать заболевания у животных с иммунодефицитными состояниями. Это эндогенные инфекции, вызванные ассоциациями микоплазм с другими микроорганизмами. 

Одним из наиболее частых симптомов является конъюнктивит. Воспаление слизистой оболочки глаз может быть одно- и двухсторонним. По характеру выделений: серозным, серозно-катаральным, и даже гнойным (в случае присоединения вторичной микрофлоры). При длительном течении, особенно в случае сочетания с вирусной инфекцией, или гноеродной микрофлорой, воспаление может распространиться на другие отделы глаза. Это может привести к серьезным офтальмологическим нарушениям. 

При поражении органов дыхания при микоплазмозе могут наблюдаться различные симптомы: от ринита до бронхопневмонии. Отмечаются выделения из носовых ходов (от серозных до гнойных), чихание, кашель. При длительном течении микоплазмозного бронхита и бронхопневмонии в органах дыхания развиваются необратимые изменения, которые приводят к таким последствиям как бронхоэктатическая болезнь и хроническая обструктивная болезнь легких. 

При микоплазмозе у собак и кошек очень часто наблюдаются поражения слизистой оболочки ротовой полости — гингивиты, которые, в зависимости от длительности течения, могут быть как поверхностными, так и эрозивно-язвенными (особенно, при сочетании микоплазмоза с другими возбудителями вирусной или бактериальной природы). Хронические гингивиты могут приводить к заболеваниям пародонта, что, в конечном итоге, приводит к потере зубов. 

При поражении органов урогенитального тракта могут наблюдаться различные симптомы. При тяжелом течении микоплазмоза возможно рассасывание эмбрионов, абортирование, щенки и котята рождаются недоразвитыми, наблюдается высокая неонатальная смертность в первые дни.  У сук регистрируются рецидивирующие вагиниты, выкидыши, мертворожденность; у кобелей – баланопоститы, уретриты, простатиты, орхоэпидидимиты, отек мошонки, снижение фертильности. 

Микоплазменная инфекция, протекающая с поражением  суставов (хронический фибринозно-гнойный полиартрит, тендосиновит) может развиться в результате распространения возбудителя из очагов активной или латентной инфекции со слизистых оболочек дыхательных путей, мочеполового тракта, конъюнктивы. Такая клиническая картина характерна для ослабленных животных и животных с иммуносупрессией. Симптоматика проявляется в виде хронической перемежающейся хромоты, нежелании двигаться, болями в суставах, отеках и опухании суставов, возможно, с лихорадкой и общим недомоганием. По некоторым данным инфекция, вызванная М. spumans, ассоциирована с синдромом полиартрита у молодых грейхаундов. 

Кожные поражения при микоплазмозе могут проявляться зудящими дерматозами различной степени выраженности. 

Диагностика микоплазмоза может проводиться различными методами лабораторных исследований. Наиболее эффективными способами лабораторной диагностики являются серологические исследования (РСК, ИФА, РНГА и др.) и метод полимеразной цепной реакции (ПЦР). Диагностическая эффективность ПЦР зависит от качества забора материала для исследования и от концентрации фрагметов ДНК в биологическом материале. При нарушении техники забора проб, а также в случаях недавнего заражения микоплазмозом возможно получение ложноотрицательных результатов. Выращивание культуры микоплазмы требует использования специальных транспортных и питательных сред. 

Лечение микоплазмоза требует системного (таблетки, инъекции) и местного (капли) назначения антибактериальных препаратов, активных в отношении данных возбудителей. Микоплазмы чувствительны к антибиотикам группы тетрациклинов, макролидов, линкозамидов, а также к фторхионолонам. Хороший терапевтический эффект наблюдается при применении комбинированных препаратов.

Учитывая то, что клиническое проявление микоплазмоза чаще наблюдается у животных с ослабленным иммунитетом, в схему лечения целесообразно включать иммуномодуляторы.

При микоплазмозе, протекающем на фоне вирусной инфекции, необходимо назначать противовирусные препараты. А при сочетании микоплазмоза с другой бактериальной инфекцией, следует учитывать чувствительность и резистентность к антибиотикотерапии. 

Иммунитет при микоплазмозе часто непродолжительный и зависит от интенсивности и формы инфекционного процесса. Разнообразие видов возбудителя, а также наличие иммуносупрессии у заболевших животных, нередко приводит к рецидивам заболевания. 

Профилактика микоплазмоза сводится к своевременному выявлению и лечению больных животных. Вакцинация не разработана.   

 

Анализ №AN313БАЛ, Микоплазма (Mycoplasma spp.) для собак и кошек: показатели, норма

Микоплазмы — бактерии из класса Mollicutes, у которых отсутствует клеточная стенка, размер клетки составляет от 0,3 до 0,8 мкм. 

Существует более 120 видов микоплазм, однако ввиду сложности видовой идентификации, не до конца ясно, какие из них вызывают инфекции у собак и кошек. Микоплазмы являются комменсальными микроорганизмами, населяющими слизистые оболочки практически всех видов млекопитающих. У собак инфекции микоплазм обычно характеризуются поражением мочеполовой системы, а также кератоконъюнктивитом и/или патологиями верхних дыхательных путей, поражением кожи и мягких тканей, менингоэнцефалитом и артритом. 

Ввиду того, что микоплазмы часто обнаруживаются в верхних дыхательных путях и половых путях здоровых животных, иногда сложно установить их роль в патологиях верхних дыхательных путей и мочеполовой системы. Микоплазмы могут вызывать вторичные инфекции при нарушении функции иммунной системы вследствие таких факторов, как неоплазия или использование иммуносупрессивных препаратов.

При колонизации микоплазмы прикрепляются к клеткам слизистой оболочки хозяина. Поражение глубоких тканей и клиническое заболевание развиваются в результате иммуносупрессии или нарушения барьерной функции слизистой оболочки. 

Передача инфекции происходит при контакте с инфицированными животными или контаминированными предметами. Устойчивость к действию факторов внешней среды и способность выживать вне организма хозяина варьируют у разных видов микоплазм. Микоплазмы обнаруживают в верхних дыхательных путях практически у всех собак, примерно у 25% здоровых собак микоплазмы находят в трахее и легких. 

Факторы, предрасполагающие к развитию микоплазменной пневмонии, не всегда очевидны. Клинические признаки при этом включают лихорадку, кашель, тахипноэ, летаргию и снижение аппетита. Микоплазмы часто определяют у собак с бесплодием и гнойным эпидидимитом, а также у здоровых собак, поэтому их роль в развитии патологий половой системы неясна.
В некоторых случаях инфекции Mycoplasma spumans и M. edwardii могут вызывать полиартрит у собак, при этом в синовиальной жидкости обычно выявляют большое количество нейтрофилов. Это может приводить к ошибочному диагностированию иммунообусловленного полиартрита. 

Обычно у животных с микоплазменным полиартритом имеет место иммуносупрессия, вызванная неоплазией или применением глюкокортикоидов.
Клинические симптомы при микоплазмозе зависят от того, какой орган поражается инфекцией, а также от наличия сопутствующих патологий. При инфекции глаз чаще отмечаются серозные или серозно-гнойные выделения, гиперемия конъюнктивы, в некоторых случаях — кератит. При поражении верхних дыхательных путей присутствуют выделения из носа и чихание, иногда сопровождающиеся конъюнктивитом. При микоплазменной пневмонии могут наблюдаться лихорадка, тахипноэ и усиление дыхательных шумов. Инфекции мочевыводящих путей сопровождаются гематурией и странгурией. При микоплазменном артрите возможны лихорадка, суставная боль и отек суставов, в некоторых случаях — лимфаденопатия.

Диагноз при микоплазмозе ставится на основании клинических симптомов, результатов лабораторных и рентгенографических исследований, бактериологического посева и ПЦР.
Существуют тест-системы ПЦР, как стандартные, так и в реальном времени, позволяющие обнаруживать ДНК микоплазм в образцах от больных животных, а также дифференцировать различные виды микоплазм. Наша лаборатория располагает тест-системами ПЦР, позволяющими дифференцировать М. сynos и M. сanis. Как и в случае с бактериологическим посевом, результаты исследования методом ПЦР должны интерпретироваться с учетом результатов всех остальных проведенных исследований и наличия сопутствующих патологий, ввиду того, что колонизация микоплазмами часто наблюдается у здоровых животных.

ПРЕАНАЛИТИКА

Для диагностики данного возбудителя доступны следующие локализации:

  • AN 332 НОС- в качестве биоматериала берут соскоб эпителиальных клеток слизистой носовой полости и помещают в микропробирку с транспортной средой. Образец стабилен при температуре +2.+8 ℃ до 10 дней;
  • AN 332 БАЛ — смыв из бронхов, полученный путем БАЛ, хранится при температуре +2.+8 ℃ до 3 дней, в пробирке с ЭДТА.

ИНТЕРПРЕТАЦИЯ

Результаты исследования содержат информацию исключительно для врачей. Диагноз ставится на основании комплексной оценки различных показателей, дополнительных сведений и зависит от методов диагностики.

РЕЗУЛЬТАТ ИССЛЕДОВАНИЯ

Обнаружение или не обнаружение в исследуемой пробе ДНК Mycoplasma felis.

лечение и профилактика в ветеринарной клинике Vetstate

В природе можно встретить огромное количество различных микроорганизмов. Некоторые из них являются полезными для животных и людей, некоторые – крайне опасными, вызывающими серьезные заболевания. Часть микроорганизмов ученые относят к условно-патогенным, то есть проявляющим себя лишь при определенных условиях. Одними из таких условно-патогенных микробов и являются микоплазмы, приводящие в некоторых случаях к развитию такого заболевания, как микоплазмоз у собак, лечение которого эффективно проводится специалистами клиники.

Микоплазма – одноклеточный паразит, широко распространенный в природе. Попасть в организм собаки он может различными путями:

• воздушно-капельный;
• контактно-обиходный;
• кормовой;
• половой;
• натальный – при прохождении щенка по родовым путям.

Считается, что собаки чаще всего заражаются микоплазмозом от кошек и декоративных крыс, именно эти животные являются носителями различного вида микоплазм.

Клиническая картина при микоплазмозе у собак

Паразиты могут «поселяться» в различных местах: половые пути, слизистые оболочки, желудочно-кишечный тракт. Попадая в организм животного, они вливаются в постоянную микрофлору, а проявляют себя как патогенные только тогда, когда у собаки сильно ухудшается иммунитет вследствие неполноценного питания и плохих условий содержания, либо в результате развития различных заболеваний.

Клиническая картина при микоплазмозе выглядит по-разному, чаще всего он проявляется следующими симптомами:

• конъюнктивит односторонний либо двухсторонний – у собаки наблюдается слезотечение, отек и покраснение конъюнктивы, гнойные либо серозные выделения из глаз;
• ринит – поражаются верхние дыхательные пути;
• микоплазма может вызывать развитие воспалительных болезней мочеполовой системы животного – уретрит, простатит, вагинит, цистит;
• иногда наличие в организме собаки этого патогенного микроорганизма приводит к возникновению микоплазменного артрита – разрушается суставной хрящ, на поверхности сустава наблюдаются выраженные эрозии, что приводит к хромоте;
• некоторые виды микоплазм могут вызвать образование подкожных абсцессов;
• часто при поражении этими микроорганизмами наблюдается повышение температуры, анемия, вялость, общее недомогание.

Для постановки точного диагноза следует обращаться в ветеринарную клинику. Там у собаки возьмут мазки с конъюнктивы, сделают смывы с бронхов и трахеи, после чего полученные материалы исследуют, используя метод полимеразной цепной реакции.

Лечение микоплазмоза у собак

Некоторые виды микоплазм очень устойчивы к различным антителам, поэтому лечение этого заболевания у собак может достаточно длительным.

Для лечения назначаются различные антибиотики – левомицетин, тетрациклины, макролиды,аминогликозиды. Эти лекарства применяются либо в виде мазей (при конъюнктивитах), либо в качестве системной терапии.

Если заражена беременная сука, ее не лечат до рождения щенков. Чтобы оградить потомство от заражения проводят кесарево сечение.

Профилактика микоплазмоза у собак играет немаловажную роль. Это коварное заболевание иногда вызывает опасные осложнения, а у беременных сук может привести к выкидышу либо преждевременным родам. Поэтому следует внимательно следить за своим питомцем, обеспечивая ему полноценное питание и хорошие условия жизни. Не лишними будут и регулярные осмотры у ветеринара, который проведет исследование флоры организма на наличие микоплазм.

Микоплазмоз у собак: симптомы и лечение.

По мнению ветеринаров, в современном мире микоплазмоз становится бичом болезней животных. Зачастую респираторные заболевания, астма, дерматиты, диареи вызываются микоплазмами.

Именно поэтому часто стандартное лечение не помогает так эффективно, как хотелось бы. А лишь на время устраняет симптомы болезней и впоследствии вызывает рецидивы. Что же такое микоплазмоз, как его диагностировать и вылечить?

Что такое микоплазмоз у собак?

Микоплазмоз — инфекционное заболевание, вызванное организмами-микоплазмами. Это не бактерии и не вирусы, а особый вид патогена, характеризующийся отсутствием клеточной стенки. Микоплазмоз обычно проходит бессимптомно, сложно диагностируется, только при исследовании внутренней микрофлоры организма собаки, и еще сложнее лечится.

Патогенные микроорганизмы в природе находятся повсеместно: в почве, воде, на растениях. Но при неблагоприятных условиях они быстро погибают. Поэтому заражение происходит главным образом при контакте с носителями болезни.

Микоплазмы имеют различные формы. Встречаются не только паразиты, но и сапрофиты, и симбиотические формы.

Около 80 процентов домашних животных являются носителями болезни, чаще всего кошки. Как правило, семейство кошачьих является носителем разных видов микоплазмоза, в том числе и собачьего микоплазмоза. Поэтому инфекция не поражает. А собака может заразиться, просто погнавшись за кошкой.

Собаки также чаще являются лишь переносчиками, но заболевают только при снижении иммунитета, стрессе или при другом заболевании, снижающем защиту организма животного.

Важно! Развивается заболевание в активную стадию только у 10 процентов носителей.

Микоплазмы обитают преимущественно на слизистых оболочках:

  • желудка,
  • кишечника,
  • дыхательных путей,
  • половых путей.

В связи с разнообразными местами локализации инфекции, путей заражения выделяется несколько:

  • так как организмы могут находиться в верхних дыхательных путях, то способ заражения — воздушно-капельный;
  • дислокация на остальные слизистые может привести к заражению половым путем, во время родовой деятельности у сук и контактным путем.

Для собак характерны урогенитальные заболевания. Заражение плода происходит внутриутробно. Осложнение болезни у сук проявляется рассасыванием эмбрионов, выкидышами. Щенки рождаются недоразвитые. Высока смертность в первые сутки после рождения. Также у сук отмечают рецидивы вагинита, не поддающиеся классическому лечению. У кобелей фиксируют уретриты, простатиты, отеки мошонки, баланопоститы.

Чаще всего поражение дыхательных путей микоплазмозом происходит у щенков.

В некоторых случаях микоплазмоз поражает суставы — в форме фиброзного полиартрита, тендосиновитов. Проявляется хромотой, болями и опухолями суставов, нежеланием двигаться, иногда сопровождается лихорадкой и общим недомоганием.

Симптомы

В силу того, что этот класс организмов представлен тремя видами (микоплазмы, уреаплазмы, ахолеплазмы) и поражают они различные органы, то явных признаков не выделяется. Симптомы зависят от пораженного органа.

При поражении органов дыхания выделяют следующие симптомы:

  • кашель;
  • чихание;
  • покраснение и отек конъюнктивы, нагноение;
  • слезотечение;
  • риниты, несвойственное породе сопение.

При воздействии на органы пищеварения:

  • отсутствие аппетита;
  • тошнота и рвота;
  • собака постоянно хочет пить;
  • при затрагивании области живота — болевые ощущения;
  • диарея;
  • скуление при мочеиспускании.

Независимо от места поражения, ветеринары выделяют несколько общих признаков:

  • суставную боль и боль в костях;
  • опухание и отекание конечностей;
  • слабость;
  • высокую температуру и лихорадку;
  • высыпания и нарывы на коже, дерматиты, абсцессы;
  • вялость, сонливость, нежелание передвигаться;
  • потерю веса.

В качестве вторичных признаков называют:

  • пневмонию, ОРЗ, инфекции глаз;
  • повреждение опорно-двигательного аппарата;
  • ослабление иммунной системы, анемию;
  • воспалительные процессы мочеполовой системы;
  • патологии почек.

Также микоплазмоз вызывает бесплодие у самок.

Важно! Заподозрить микоплазмоз хозяин может, если симптомы и признаки стали проявляться у любимца после перенесенного заболевания, требующего прием препаратов, подавляющих иммунитет.

Передается ли человеку?

До конца точно не выяснено, может ли человек заразиться от собаки. Но врачи с большой уверенностью говорят, что нельзя. Это связано с тем, что организм человека не поддается воздействию того типа микоплазмы, которым заболевают собаки. Но при этом стоит соблюдать элементарные правила гигиены при общении с питомцами. Следует оградить общение с заболевшим питомцем людей, имеющих ослабленный иммунитет: детей, стариков.

Другим собакам и животным

Микоплазмоз передается исключительно от вида к виду. То есть от человека к человеку, от одного животного к другому. Так, кошки заражаются друг от друга, но могут заразить и собак. Так как являются переносчиками микоплазмоза собак. Собаки также заражаются друг от друга. Также инфицирование щенков может проходить во время родов, если мать заражена.

Анализы

Для точной постановки диагноза ветеринары назначают ряд анализов:

  • Общий и биохимический анализ крови. В общем анализе диагностируется незначительная анемия, повышенное количество нейтрофилов. В биохимическом анализе — гипоальбуминемия, гипоглобулинемия.
  • Общий анализ мочи — выявляется повышенное содержание белка.
  • Серологические исследования — показывают наличие антител и антигенов микоплазмы в сыворотке крови.
  • Мазки по Романовскому-Гимзе (цитологический метод окрашивания микроорганизмов) — позволяет выявить кокки кольцевидной, спиралевидной и нитевидной формы.
  • Мазки на конъюнктивит.
  • Смывы с бронхов, со слизистых половых органов.
  • Рентген абдоминальной области.
  • УЗИ внутренних органов.

Результаты исследуются методом ПЦР.

Как лечить?

Лечение микоплазмоза у собак протекает достаточно долго, с использованием специальной схемы терапии.

Важно! Вылечить заболевание можно только комплексно, с четким соблюдением всех предписаний ветеринара.

Для того чтобы назначить эффективное лечение, необходимо точно определить тип микоплазмы, которым поражен организм собаки, для этого и проводится комплекс анализов.

Важно! Пенициллин и цефтриаксон не способны помочь при микоплазмозе.

В общем виде терапия выглядит таким образом (точные лекарства назначает врач при определении типа патогена):

  • Терапия антибиотиками — обязательный этап лечения. Так как организмы быстро приспосабливаются к лекарствам, ветеринары назначают одновременно две группы антибиотиков. В случае необходимости они замещаются другими, например тилозином, левомицетином, эритромицином.
  • Препараты для поддержания печени — необходимы потому, что антибиотики сильно влияют на функцию печени.
  • Иммуностимуляторы — повышают защитную функцию организма.
  • Средства от конъюнктивита — капли и мази.
  • Муколитические средства при кашле.
  • Противовоспалительные — если есть признаки цистита или уретрита.
  • Обезболивающие.

Во время лечения необходимо обязательно повторное посещение врача для контроля эффективности терапии и при необходимости смены лекарств.

Собаку, зараженную микоплазмозом, вынашивающую щенков, не лечат. Как правило, дожидаются родов, но рожать естественным путем не дают, чтобы исключить заражение щенков, а делают кесарево сечение.

Важно! Запущенный микоплазмоз может вызвать энтерит и чумку.

Профилактика

Вакцины, защищающей собаку от этого заболевания, не существует. Но ряд профилактических мер способен если не предотвратить, то значительно снизить риск подхватить инфекцию. К таким мерам относятся:

  • ограничение контакта собаки с бездомными животными;
  • запрет подбирать пищу с земли;
  • регулярное посещение ветеринара и сдача анализов на исследование микрофлоры;
  • своевременная вакцинация и антипаразитарная обработка;
  • полноценное здоровое питание и витаминная профилактика;
  • качественные условия жизни — будку необходимо регулярно вычищать, коврик — стирать; миски всегда должны быть чистыми, а вода свежей;
  • беречь от переохлаждения и стрессов;
  • обязательное обследование на микоплазмоз перед вязкой — это связано с тем, что заболевание опасно для беременной суки и эмбриона (обследовать следует собак обоих полов).

Микоплазмоз — коварное и опасное заболевание собак. Как только у владельца появились первые подозрения, что с питомцем что-то не так, необходимо сразу обратиться к специалисту. Не стоит заниматься самолечением, так как неправильно выбранная терапия способна усугубить ситуацию, привести к осложнениям, вылечить которые будет невозможно.

По заверениям ветеринаров, эта болезнь эффективно поддается лечению антибиотиками при правильном назначении препаратов и дозировки. При соблюдении всех назначений, правил гигиены и ухода за питомцем, его шансы на полное выздоровление очень велики. А дальнейшее соблюдение мер профилактики и укрепление иммунитета позволят не только не допустить рецидивов, но и снизить риск заражения другими болезнями. Здоровые, активные питомцы, получающие правильное питание, регулярные физические нагрузки, а также внимание и любовь хозяев, не болеют ничем.

Инфекционное респираторное заболевание у собак / Внебольничная пневмония у собак • MSPCA-Angell

Аманда Лохин, DVM
MSPCA-Angell West
[email protected]
781-902-8400

Кашляющая собака — обычное явление в любой ветеринарной больнице. Сам по себе кашель может быть клиническим признаком множества болезненных процессов, включая первичное заболевание легких / дыхательных путей, сердечное заболевание или рак.Распространенной причиной кашля у здоровой собаки является заболевание, называемое инфекционным респираторным заболеванием собак (CIRD), обычно называемое «собачьим кашлем». Это общий термин для нескольких различных вирусов и бактерий, большинство из которых очень заразны и могут вызывать респираторные инфекции у собак.

Наиболее распространенные патогены CIRD включают Bordetella bronchiseptica , вирус парагриппа собак, аденовирус собак-2 и Mycoplasma cynos . Двумя из МЕНЬШЕ распространенных причин с потенциально более высокой заболеваемостью являются вирус собачьего гриппа и вирус чумы собак.Все эти патогены, за исключением Mycoplasma , которая является нормальным, но условно-патогенным обитателем дыхательных путей у собак, передаются через респираторные выделения других инфицированных собак. Они также могут передаваться через прямой контакт собаки с собакой и через зараженные предметы (например, руки человека, одежду и т. Д.). В зависимости от возбудителя инфекции инкубационный период CIRD может составлять от 48 часов до 10 дней.

В большинстве случаев CIRD клинические признаки легкие и могут включать частый, а иногда и довольно громкий и тревожный кашель, чихание и желто-зеленые слизистые выделения из глаз и носа.Кашель можно охарактеризовать как отрывистый кашель, часто заканчивающийся терминальной рвотой, при которой может выделяться слизь и даже желудочное содержимое, что часто ошибочно принимают за рвоту. Иногда это также вызывает опасения, что что-то застряло собаке в горле. При физикальном осмотре кашель обычно можно выявить при пальпации трахеи.

Лихорадка, летаргия, потеря аппетита и затрудненное дыхание относительно редки, но могут возникать у собак, которые страдают более серьезно: обычно у щенков, невакцинированных собак или собак с ослабленным иммунитетом.Когда присутствуют эти более серьезные клинические признаки, первичное беспокойство вызывает пневмония, вторичная по отношению к CIRD (также известная как внебольничная пневмония). Чаще всего собаки с более серьезными симптомами и пневмонией инфицированы более чем одним антигеном CIRD.

Собака с двусторонними выделениями из носа. Фото доктора Крейга Датца, VIN

В случаях, когда Mycoplasma или Bordetella (обе бактерии) являются одним из возбудителей, они могут напрямую колонизировать легкие и приводить к пневмонии.Однако вирусные антигены CIRD также могут приводить к пневмонии, поскольку вирусы часто разрушают нормальные респираторные клетки и снижают способность дыхательных путей защищаться, что приводит к вторичным бактериальным инфекциям с условно-патогенными микроорганизмами (такими как Staphlococcus spp., Streptococcus spp. ., Pasteurella spp. ). В идеале при пневмонии следует получить образец секрета дыхательных путей, чтобы определить, какие бактерии присутствуют и какой антибиотик будет наиболее эффективным.

Поскольку некоторые из этих вирусов являются заболеваниями, подлежащими регистрации (а именно, вирус чумы собак и вирус собачьего гриппа), всегда рекомендуется проводить тестирование на сильно пораженных животных для определения возбудителя (ов). Бактериальные агенты можно выращивать в культуре, но анализ ПЦР (полимеразная цепная реакция) является наиболее практичным, точным и легкодоступным тестом для обнаружения вирусов. Для этого теста требуется только мазок из глубокого носа и мазок из глотки (задняя стенка глотки), поэтому получение образцов относительно легко и безболезненно для домашнего животного.Присутствие пневмонии выявляется с помощью рентгенограмм грудной клетки (рентгеновских снимков), и рекомендуется анализ крови на исходном уровне для оценки состояния гидратации и иммунного ответа пациента (убедитесь, что у них достаточно лейкоцитов для борьбы с инфекцией). В редких случаях внебольничная пневмония может быть достаточно серьезной, чтобы вызвать сепсис или привести к респираторной усталости и остановке дыхания.

Рекомендации по диагностике и лечению зависят от индивидуальной оценки пациента. Собаки с легким поражением и незначительными клиническими признаками часто не нуждаются в лечении антибиотиками, так как инфекции проходят самостоятельно и проходят в течение 7-10 дней.Следует рассмотреть возможность применения антибиотиков при лихорадке, вялости, потере аппетита, слизисто-гнойных выделениях из носа или при обнаружении пневмонии. Собакам с пневмонией часто требуется госпитализация для внутривенного введения антибиотиков и, возможно, кислородной терапии. Противокашлевые средства (лекарства от кашля) можно рассмотреть для собак, у которых нет пневмонии, но они противопоказаны любому животному с пневмонией.

Вакцинация — самая важная профилактическая мера в борьбе и профилактике CIRD, и вакцины доступны для большинства возбудителей.Хотя большинство этих прививок не вызывают полного иммунитета (за исключением вируса чумы собак), вакцинированные собаки, как правило, имеют более низкую заболеваемость (клинические признаки менее серьезны) и имеют тенденцию выделять меньше антигена с респираторным секретом (поэтому могут быть менее заразными). другим собакам). Поскольку большинство антигенов CIRD очень заразны, управление окружающей средой также очень важно для снижения распространения CIRD. Больных собак следует изолировать от других собак по крайней мере на несколько дней после исчезновения клинических признаков.

% PDF-1.2 % 1 0 объект > поток конечный поток эндобдж 2 0 obj > поток х +

(PDF) Смертельная бронхопневмония, вызванная Mycoplasma cynos в помете щенков золотистого ретривера

The Veterinary Record, 3 ноября 2007 г.

Летальная

бронхопневмония

вызванная Mycoplasma

золотистых ретриверов

в помете щенки

F.Zeugswetter, H. Weissenböck,

S. Shible, J. Hassan, J. Spergser

МИКОПЛАЗМЫ — самые маленькие и самые простые из известных свободноживущих организмов

; они широко распространены в царстве животных —

dom (Waites and others 2005). Принято считать, что

верхних дыхательных путей собак часто заселяют

микоплазмами, где они, по-видимому, составляют часть нормальной бактериальной флоры

(Rosendal 1982, Randolph and oth-

ers 1993).Имеются противоречивые сообщения об инфекциях

нижних дыхательных путей (Rosendal 1972, Randolph и

др. 1993). Микоплазмы были выделены отдельно или в комбинации

с другими бактериями из легких собак с

легочными заболеваниями (Кирхнер и др. 1990 г., Рэндольф и

др. 1993 г., Джеймсон и др. 1995 г., Чандлер и Лаппин

2002 г., Чалкер и др. другие 2004). Мало что известно о конкретных

инфекциях, вызываемых видами Mycoplasma собак.Rosendal

(1978) выделил различные микоплазмы, но только Mycoplasma

cynos была способна вызвать воспалительный ответ после

эндобронхиальной инокуляции недельных щенков. Это короткое сообщение

описывает случай M cynos pneumonia

в помете щенков золотистого ретривера.

Изначально помет состоял из 11 щенков, из которых четыре

с низким весом при рождении (примерно 280 г по сравнению с

400–450 г для других щенков) выцвели и умерли в течение

первых двух недель жизни.Заводчик заметил выделение молока из ноздрей у двух щенков после кормления —

, но расщелина неба

была исключена как причина. Патологоанатомическое исследование —

исследований не проводилось. Помет, семилетняя мать

(средний размер помета которой за предыдущие шесть лет составлял 11

щенков) и восемь других собак (один золотистый ретривер, три таксы

и четыре мопса) принадлежали заводчику. были осмотрены частным ветеринаром заводчика

, но не имели признаков заболевания.Бесплодия, абортов, мертворождений,

болезней или смертей не наблюдалось в течение последних двух

лет. Питомники были чистыми, явных проблем в ведении племенного хозяйства

не наблюдалось.

В возрасте трех недель у оставшихся семи щенков развились

признаков верхних дыхательных путей с ринореей, за которыми последовали

лихорадки (до 41 ° C) и продуктивный кашель в течение нескольких дней.

Собаки дали отрицательный результат на аденовирус собак (

CAV) типов

1 (

CAV-1) и 2 (CAV-2) методом ПЦР на мазках из носа и

изо рта и сыворотки, а также на вирус чумы собак. (

CDV) методом ПЦР

на мазках с конъюнктивы и цельной крови.Трое щенков умерли

, несмотря на лечение, включая амоксициллин (Роксилин; Norbrook

Laboratories). Макроскопическое патологоанатомическое исследование

одного из этих щенков выявило бледные органы и ткани, предположительно,

с тяжелой анемией, гистологически подтвержденным серофибринозным плевритом

низкой степени, а также глубоко консолидированными и

пятнистыми легкими без значительных спаек. Кроме того,

была продемонстрирована тяжелая аскаридная инфекция желудка и тонкого кишечника,

зубца без обструкции.В остальных органах патологически

логических изменений не обнаружено.

Гистопатология легких показала тяжелую острую генерализованную

катарально-гнойную, частично геморрагическую фибринозную

некротизирующую бронхопневмонию. Иммуногистохимическое исследование

(

ИГХ) фиксированной формалином, залитой парафином ткани легкого

с использованием поликлональных антител к M cynos выявило

Ветеринарный отчет (2007)

161, 626-628

F.Zeugswetter, DrMedVet,

Клиника внутренних болезней

Медицина и инфекция

Клиника болезней

Отделение мелких животных

Животные и лошади,

H. Weissenböck,

DrMedVet,

DrMedVet, S.

Институт патологии

и судебно-ветеринарной медицины

Медицина,

Дж. Хассан, DrMedVet,

Клиника радиологии, клиническая

Диагностическое отделение

Инфекционное отделение

Болезни и лаборатория

Spergser, DrMedVet,

Институт бактериологии,

Микология и гигиена,

Ветеринарный университет

Медицина, Вена, Австрия

обильные точечные сигналы, особенно на границах тяжелого нейтрофильного воспаления

(рис. 1). Специфического окрашивания

не было обнаружено у шести отрицательных контролей (собаки соответствующего возраста без легочной болезни

). Поскольку ни типичное поражение легких,

печени, почек и селезенки, ни присутствие эозинофильных

внутриядерных телец включения не было продемонстрировано, текущая инфекция вируса герпеса собак

считалась крайне маловероятной.Возможные сопутствующие инфекции

CDV и

CVA-1 или CAV-2 были исключены на основании ПЦР, IHC или тестов гибридизации in situ

(Benetka and others 2006).

Образцы тканей легких культивировали с использованием обычных методов

для выделения и дифференциации аэробных и

анаэробных бактерий, микоплазм и грибов (Spergser и

others 2002). Микоплазмы были культивированы исключительно и в большом количестве из образцов легочной ткани и идентифицированы как M cynos с помощью

иммунофлуоресцентного теста с использованием видоспецифической антисыворотки

(Bradbury 1998).

Лечение линкомицином (Linco Spectin; Pharmacia

, Австрия), антибиотиком, который, как известно, является эффективным против многих

микоплазм, вводился внутримышечно в дозе 15

мг / кг, и было начато лечение оставшихся четырех щенков, двое из которых

с клиническими признаками тяжелой бронхопневмонии

и плеврита. Рентгенография грудной клетки одного из этих щенков

показала диффузный альвеолярный паттерн в средней доле легкого —

, усиленный бронхиальный и интерстициальный паттерн, небольшое увеличение плевральной жидкости на

и увеличение лимфатических узлов средостения

.Подсчет лейкоцитов у этого щенка выявил лейкоцитоз

(30 · 0 x 10

3

лейкоцитов / мкл, среднее [sd] эталонное значение

для щенков золотистого ретривера 15 · 3 [3 · 8] x 10

3

лейко-

цитов / мкл [Mischke and others 2003]) с нейтрофилией (20,4

x 10

3

/ мкл полосовых нейтрофилов, контрольное значение 6 · 44 [2 · 11] x 10

3

),

, но нормальное количество лимфоцитов (7 · 7 x 10

3

лимфоцитов / мкл,

контрольное значение 7 · 46 [2 · 19] x 10

3

).Объем упакованных клеток, глюкоза

, креатинин, общий белок и уровни аланинаминотранс-

феразы были в пределах нормы.

После одной недели с минимальным улучшением лечение

было изменено на эритромицин 15 мг / кг (Erystad; Stada),

перорально три раза в день. После этого у собак улучшилось быстродействие

на холостом ходу, и никаких респираторных признаков не наблюдалось в течение следующих восьми месяцев.

Были взяты мазки из глотки, носа, молока и влагалища

суки для микробиологического исследования.M cynos и

Mycoplasma canis были выделены только из глоточного мазка

.

Результаты гистопатологического и микробиологического исследований

позволяют предположить, что M cynos сыграли центральную роль в

развитии бронхопневмонии и плеврита у

щенков. Инфекция, возможно, возникла в результате пероральной передачи от суки. Наблюдаемая широко распространенная острая фибрино-гнойная форма

до геморрагической / некротизирующей плевропневмонии

значительно отличалась от более легких и менее распространенных поражений

, описанных Rosendal (1978) после эндобронхиальной инокуляции

недельных щенков

клонированной культурой

. M cynos.Экспериментальная пневмония гистологически характеризовалась тяжелым локализованным нейтрофильным, а затем моно-

ядерным воспалением бронхов и прилегающих тканей.

Увеличение прикорневых лимфатических узлов произошло от четырех до пяти

недель после инокуляции. Избыточная плевральная жидкость и внутригрудная лимфаденопатия также наблюдались у 22%

детей с микоплазменной пневмонией (Guckel и др.,

, 1989).Тот факт, что симптомы респираторной инфекции на

ухудшились, несмотря на лечение амоксициллином, также коррелирует

с поражением микоплазм (Chalker 2005). Отсутствие у

типичной бактериальной клеточной стенки, содержащей пептидогликаны

, делает микоплазмы нечувствительными к активным в клеточной стенке антимикробным агентам

(Bemis 1992). Миграция личинок Toxocara canis

через легкие могла усугубить тяжесть

болезни, хотя это считается маловероятным, поскольку поражения легких

не связаны с миграциями личинок у неона-

талых собак (Blunden 1988).Лечение макролидами, которые

Краткие сообщения

(PDF) Mycoplasma canis и урогенитальные заболевания у собак в Норвегии

В эти разискави смо проучевали погост оболенй псов знаки болезни счил в диагностических параметрах вредных факторов развития. Овреднотили см действия твеганя за посамезне болезни в поударили помен целовит исправнаве пациента озирома впоглед в различна клинична станя. В prospektivni epizootiološki raziskavi SMO obravnavali 191 псов, PRI katerih SMO zbrali anamnestične podatke, opravili klinični Отель Обзор в ultrazvočno preiskavo trebuha, основно analizo в mikrobiološko preiskavo Урина, тер против indiciranih primerih С.Е. kvantitativno analizo urolitov, hematološke preiskave, biokemijske preiskave krvi, rentgensko slikanje trebuha в / али прснега коша, предварительно простатичнега изпирка в редкее дроге преискаве.Наиболее эффективные диагнозы при психических заболеваниях, когда есть признаки болезни, были выявлены, если они были представлены, 34,4 одностороннего диагноза, при мочеиспускании, 14,3 односторонних диагнозов. Okužba je bila pogostejša pri kastriranih živalih, pri samicah, starejših živalih in živalih s socasnimi boleznimi. Найпогостейши повзрочители мочевых окужб псов так желчные энтеробактерии, ки так представлены 55,9 одстотка изолатов, в стафилококи, ки так представлили 27,1 одстотка изолатов. Najpogostejša enterobakterija je bila E.coli, ки я представляла 39,0 одсотков изолатов. Okužbo je večinoma (pri 90,7 odstotka psov) povzročila ena vrsta bakterije. В 95,4 одстотка примеров окужб см в 1 мл мочи подготовили> 106 колонийских енот (КОЕ). Za vsa testirana protimikrobna zdravila je bilo občutljivih 29,4 odstotka izolatov, sekundarno odpornih proti eni skupini protimikrobnih zdravil je bilo 25,2 odstotka, proti dvema skupinama je bilo 25,2 odstotka, proti dvema skupinama je bilo 25,2 odstotka, proti dvema skupinat je bilo odilhustratno 27,6 odstratno При псих, ки со били предходно здравли с протимикробными здравили, так желчные бактерии погосте одпорне проти ени, двема али вец скупинам протимикробных здравил кот при псих, ки предыдно нисо б.Мед вечно одпорными бактериями, так что билли диагностически в терапевтско больших поражениях примерами окужб з бактериями Staphyloccus pseudintermedius, одпорно проти метицилину (MRSP) в E. coli с беталактамазами группы (ESCB). Найпогостиши уролити при псих со били струвитни (44,4 одстотка), редкейши па оксалатни (26,7 одстотка) в уратни (11,1 одстотка). За правильно поставитев диагноз в одлочитэв за здравлье со били в 11,5 одстотка всех примеров потребни результатов микробиолошке преискаве в квантитативном анализе уролита.Это исследование было разработано для изучения частоты заболеваний, проявляющихся признаками заболевания мочевыводящих путей, и диагностической ценности различных качественных и количественных параметров. Были оценены предрасполагающие факторы и сделан упор на полное рассмотрение пациентов. В проспективное эпизоотологическое исследование была включена 191 собака с признаками заболевания мочевыводящих путей. Были собраны анамнестические данные и выполнены клиническое обследование, УЗИ брюшной полости, общий анализ мочи и посев мочи. По показаниям также проводились количественный анализ уролитов, гематология, биохимия сыворотки, рентгенография, цитология и посев смывной жидкости предстательной железы или другое.Наиболее часто диагностировались инфекции мочевыводящих путей (у 34,4% всех диагнозов) и мочекаменная болезнь (у 14,3%). Инфекции мочевыводящих путей чаще встречались у кастрированных животных, сучек собак, пожилых собак и животных с сопутствующими заболеваниями. Чаще всего инфекции мочевыводящих путей вызывались энтеробактериями (55,9% изолятов), при этом кишечная палочка была изолирована в 39,0% случаев, а стафилококки (27,1% изолятов). Один вид микроорганизма выделен в 90,7% случаев. Более 106 колониеобразующих единиц (КОЕ) возбудителей в 1 мл мочи были культивированы в 95.4%. Возбудители были в 29,4% чувствительны ко всем протестированным противомикробным препаратам. Приобретенная невосприимчивость к одной группе противомикробных препаратов отмечена у 25,2%, а к двум группам противомикробных препаратов — у 17,6% выделенных микроорганизмов. У 27,7% бактерий была множественная лекарственная устойчивость. Устойчивые бактерии чаще выделялись от собак, ранее леченных противомикробными препаратами. Среди бактерий с множественной лекарственной устойчивостью случаи инфицирования метициллинорезистентными Staphylococcus pseudintermedius (MRSP) и E.coli с бета-лактамазами расширенного спектра (ESBL / AmpC) были диагностически и терапевтически более сложными. У собак с уролитами струвиты были наиболее многочисленными, на их долю приходилось 44,4% уролитов. Оксалатные уролиты обнаружены в 26,7%, уратные уролиты — в 11,1%. В 11,5% случаев для правильного диагноза и принятия решения о лечении потребовались результаты микробиологического и количественного анализа уролитов.

Микоплазма | eClinpath

Собачий

Mycoplasma haemocanis (ранее Haemobartonella canis ) редко вызывает анемию у собак с нормальной селезенкой и нормальной иммунной системой.Клиническая анемия может развиться при проведении спленэктомии собаке-носителю или при переливании крови донора-носителя. M. haemocanis может быть широко распространенной латентной инфекцией у собак, выращиваемых в питомнике. Этих собак обычно используют для исследований во всем мире, и существует вероятность таких хронических инфекций, которые могут искажать результаты исследований, полученных на этих животных. Опухоли или инфаркт селезенки, лечение иммунодепрессантами и сопутствующая инфекция, вызванная Babesia , Ehrlichia , а также бактериальные или вирусные заболевания также могут сделать собаку уязвимой для острого заболевания.Экспериментальная передача паразита была осуществлена ​​с использованием коричневого собачьего клеща ( Rhipicephalus sanguineus, ). Клинические признаки и гематологические данные обычно связаны с внесосудистой гемолитической анемией.

Есть несколько сообщений о небольшой гемоплазме, M. haematoparvum , у собак. Этот организм тесно связан с кошачьей бактерией M. haemominutum . Значение заражения собак этой бактерией в значительной степени неизвестно.

Кошачий

Mycoplasma haemofelis

Mycoplasma haemofelis (ранее Haemobartonella felis ) — эпицлеточный бактериальный паразит эритроцитов кошек, который может вызывать гемолитическую анемию. В мазках крови, окрашенных полихромными пятнами, организмы распознаются как маленькие синие кокки, кольца или палочки по краям или поперек эритроцитов. Осадок красителя часто ошибочно принимают за организмы, что приводит к ненужному введению тетрациклина.

Гемолитическая анемия, вызванная M. haemofelis , называется инфекционной анемией кошек (FIA) и обычно носит регенеративный характер (если основное заболевание не подавляет регенеративный ответ, например, инфекция, вызванная вирусом лейкемии кошек). Следовательно, нерегенеративная анемия у кошки с M. haemofelis требует дальнейшего обследования на предмет другого болезненного процесса и не должна полностью относиться к инфекции M. haemofelis . В этой ситуации вполне вероятно, что основное заболевание приведет к рецидиву M.haemofelis при бессимптомном носителе. Исключение составляет острая инфекция M. haemofelis , когда не было достаточно времени для ответа костного мозга.

При инфекционной анемии кошек паразитемия носит эпизодический характер со снижением гематокрита во время паразитемии. Из-за циклической паразитемии микроорганизмы могут быть многочисленными, редкими или не обнаруживаться в данном образце крови, как показано на графиках ниже.

Изменения объема упакованных клеток (PCV), температуры и паразитов крови у кошки после инокуляции Mycoplasma haemofelis в день 0.Фаза А: препаразитемическая фаза; Фаза B: острая фаза; Фаза C: фаза восстановления; Фаза D: фаза несущей.

Считается, что отсутствие организмов связано с преходящей секвестрацией паразитированных эритроцитов в селезенке с удалением организмов и высвобождением эритроцитов с сокращенной продолжительностью жизни. Тяжесть анемии не коррелирует со степенью паразитемии и часто бывает хуже у животных с основным заболеванием. Кошки часто одновременно являются положительными по Кумбсу и могут демонстрировать холодовую агглютинацию (агглютинация часто наблюдается в пробирках с кровью, хранящихся в холодильнике).У некоторых кошек также может наблюдаться тромбоцитопения. Иктеричность встречается довольно редко из-за инфекции M. haemofelis . Большинство кошек, инфицированных M. haemofelis , становятся бессимптомными носителями и повторно развивают более легкие версии болезни при стрессе.

Диагностика M. haemofelis осуществляется путем обнаружения микроорганизма в мазках крови. Как упоминалось выше, организмы не могут быть обнаружены из-за циклической паразитемии с сокращающимся числом паразитов.Обратите внимание, что микроорганизмы выпадают из эритроцитов в старых образцах крови (> 24 часов) и могут быть ошибочно приняты за осадок окрашивания, поскольку они находятся между эритроцитами, а не на них, как ожидалось. Это может привести к ошибочному диагнозу. Новые диагностические тесты на основе ПЦР становятся все более коммерчески доступными и очень полезны для кошек с низким уровнем паразитемии или субклинических носителей.

Mycoplasma haemominutum

Mycoplasma haemominutum — это небольшой паразит эритроцитов, который вызывает лишь минимальные клинические признаки острого заболевания и незначительные гематологические изменения у инфицированных кошек.В каждом эритроците обнаруживаются единичные, а иногда и множественные организмы, однако их гораздо труднее увидеть, чем M. haemofelis . Разница в вирулентности между этими двумя паразитами эритроцитов ( M. haemofelis и M. haemominutum ) у кошек может быть просто дозозависимым эффектом. Было высказано предположение, что инфекции гемоплазмы у кошек могут усугубить прогрессирование заболеваний, связанных с FeLV.

Блохи, инфицированные M. haemofelis , могут передавать паразитов и вызывать заболевание у восприимчивых кошек, тогда как экспериментальная передача M.haemominutum от блох не принесла успеха. Хотя лечение доксициклином или энрофлоксацином может контролировать острые инфекции у кошек, ни один из протестированных на сегодняшний день антибиотиков не избавляет животное от паразитов навсегда, что приводит к хроническому носительству.

КРС

Mycoplasma wenyonii

Mycoplasma wenyonii (ранее Eperythrozoon ) — это вид гемопаразита микоплазмы, поражающий крупный рогатый скот. Клинические признаки необычны, они включают острое начало отека задних конечностей и мошонки (у мужчин) или вымени (у женщин).У крупного рогатого скота наблюдается лихорадка, а у коров снижена надойность. Это особенно часто встречается у послеродовых телок. У быков паразит может вызвать снижение фертильности из-за дегенерации яичек. Заболевание носит сезонный характер с лета до осени. Пораженный крупный рогатый скот страдает анемией (обычно нерегенеративной) с легкой тромбоцитопенией. Организмы наблюдаются прикрепленными к эритроцитам и свободными в цитоплазме. Во время острой фазы у инфицированных животных наблюдается легкая лимфаденопатия, лихорадка и скелетно-мышечная ригидность.Признаки часто сохраняются в течение 2-5 дней, затем проходят.

Свинина

Mycoplasma suis

Mycoplasma suis и Mycoplasma parvum (ранее — Eperythrozoon spp.) — это некультивируемые, безостенные бактерии свиней, которые паразитируют на поверхности эритроцитов. Присутствие двух разных видов у свиней было установлено с помощью перекрестных инокуляционных исследований. Кроме того, они различаются по размеру ( M. suis варьируется от 1 мкм до 2,5 мкм, , тогда как M.parvum меньше на 0,5 мкм) и степень паразитемии (у M. suis часто наблюдается много паразитов, тогда как у M. parvum паразитемия низкая).

M. suis может вызывать клиническую гемолитическую анемию у молодых свиней в естественных условиях, но инфекции, вызванные M. parvum , не вызывают явного заболевания. Клинический синдром, связанный с инфекцией M. suis , получил название желтушной анемии свиней. Заболевание может проявляться в виде тяжелой острой анемии с лихорадкой, желтухой, анорексией, депрессией и мышечной слабостью.Паразитемия высока на ранней стадии клинического заболевания, но быстро исчезает по мере увеличения количества ретикулоцитов. Субклиническое заболевание может снизить продуктивность размножения и прибавку в весе. Передается обычная боровая вошь ( Haematopinus suis ). Заболевание диагностируется путем идентификации паразита в мазках крови, серологических исследованиях (IHA и ELISA) и методами ПЦР.

Camilidae

Mycoplasma haemolamae

Инфекция Mycoplasma haemolamae (ранее Eperythrozoon ) была обнаружена у лам и альпак.Молодые животные более восприимчивы к острой инфекции, что приводит к массивной паразитемии, связанной с анемией. Анемия плохо регенерирует (хотя можно увидеть ядросодержащие эритроциты). В случаях с высокой паразитемией многие эритроциты покрыты организмами, имеющими форму кольца, кокков и палочек (см. Изображение справа). Организмы отделяются от поверхности эритроцитов при хранении (через 1 час после сбора; это усугубляется охлаждением). У лам с хроническими инфекциями может быть множество клинических проблем, включая плохую бережливость и плохую прибавку в весе, что, как считается, связано с аномальной иммунологической функцией.Вопрос о том, связан ли этот организм с анемией, является предметом споров. Мы видели случаи тяжелой паразитемии у животных без анемии. У 34 клинически здоровых неанемичных верблюдов у животных, которые были положительными по результатам ПЦР, не было более низких показателей количества эритроцитов, упакованных объемов клеток или концентрации гемоглобина, чем у животных с отрицательным результатом ПЦР (Viesselmann et al, 2019). Подобные результаты были получены в более раннем исследовании перуанских и чилийских животных (Tornquist et al 2010). Однако ни у одного из животных не было организмов в крови, и вполне вероятно, что они были бессимптомными носителями (и могли иметь низкие паразитемии).

KoreaMed Synapse

Микоплазмы относятся к классу Mollicutes. Они являются одними из самых маленьких свободноживущих микроорганизмов, способных к авторепликации. Они очень привередливы, трудны в культивировании и медленно растут [1]. Многие виды являются важными ветеринарными патогенами и вызывают респираторные инфекции, мастит, конъюнктивит, артрит и, нечасто, аборты [1]. Сообщалось, что микоплазменные инфекции очень заразны и очень распространены в области медицины лабораторных животных [2].Необходимо определить степень контаминации Mycoplasma в колониях лабораторных животных, потому что эти организмы распространены в коммерческих и исследовательских помещениях для животных [3], а микоплазменные инфекции у лабораторных животных влияют на результаты биомедицинских исследований [4]. Считается, что микоплазмы являются частью нормальной бактериальной флоры верхних дыхательных путей у собак [5], но были противоречивые сообщения о наличии микоплазм в нижних дыхательных путях здоровых собак.Randolph et al. [6] обнаружили, что легкие до 27% здоровых собак были колонизированы, но другие авторы не смогли воспроизвести эти результаты [5]. Роль отдельных видов Mycoplasma в респираторных инфекциях собак изучена недостаточно. [5] M. bovigenitalium , M. canis , M. cynos , M. edwardii , M. feliminutum , M. gateae и M. spumans были изолированы от собак. при респираторных заболеваниях [7,8].Пневмония у собак была воспроизведена экспериментальной эндобронхиальной инокуляцией изолятом M. cynos , выделенным от собаки с пневмонией, и контактом неинфицированных собак с инфицированными собаками [9,10]. Кроме того, было описано несколько случаев, в которых чистые культуры микоплазм были изолированы от собак с респираторными заболеваниями, но типирование на уровне видов не проводилось [6,11]. Общая важность и распространение M. cynos , механизмы патогенности и природа иммунного ответа на этот патоген в настоящее время неизвестны.Сообщается, что анализ полимеразной цепной реакции (ПЦР) является простым и полезным методом быстрого скрининга большого количества животных на наличие микоплазм [12], и его можно проводить неинвазивно с помощью мазков из носа. Однако может потребоваться несколько анализов ПЦР из-за большого количества видов Mycoplasma [1].

В этом исследовании мы обнаружили микоплазму у инфицированной лабораторной собаки с помощью консенсусной ПЦР для определенного рода с использованием 16S рибосомной ДНК. После этого было идентифицировано Mycoplasma cynos с помощью видоспецифической ПЦР.

Двадцать самцов собак породы бигль (возраст 1 год) были получены из животных Центра развития ресурсов животных Университета Вонкванг, Корея. Эксперименты на животных в этом исследовании проводились в соответствии с этическими процедурами IACUC университета Вонкванг. За предыдущие 7 дней у 1 собаки (№ 8) развился сухой кашель, анорексия, рвота и депрессия. Ни у одной из остальных 19 собак не было симптомов. Все собаки, в том числе № 8, прошли медосмотр и лабораторные обследования.Сонография брюшной полости и рентгенография не выявили патологических изменений. У всех 20 собак были взяты мазки из носа. Забор пробы проводился из ноздрей сухими, не увлажненными тампонами. Кончик тампона вводили в ноздри и перекатывали по 5 раз в каждую ноздрю. Образцы транспортировали и хранили при комнатной температуре. Образцы были обработаны для ПЦР-анализа в течение 24 часов после сбора. Каждый тампон помещали в 2 мл 0,1 М буфера PBS, встряхивали и отбрасывали, и PBS использовали для экстракции геномной ДНК для анализа консенсусной ПЦР Mycoplasma .

Собака № 8 была усыплена и вскрыта. Во время аутопсии были взяты образцы тканей из легких, и были зарегистрированы макроскопические и микроскопические наблюдения за патологическими поражениями. Для идентификации Mycoplasma свежие ткани отправляли на видоспецифический ПЦР-анализ.

Для гистопатологического наблюдения ткани легких фиксировали в 10% нейтральном забуференном формалине. После фиксации ткани обычным образом залили парафином. Срезы нарезали толщиной 4 мкм, плавали на водяной бане, помещали на предметные стекла и окрашивали гематоксилином и эозином.После окрашивания было проведено микроскопическое исследование.

Легочную ткань собаки № 8 гомогенизировали и ресуспендировали в PBS. Затем суспензия легочной ткани и образцы мазков из носа были отправлены на извлечение ДНК, как описано ранее [13]. Вкратце, геномную ДНК выделяли с использованием набора для экстракции геномной ДНК AccuPrep (Bioneer Corporation, Тэджон, Корея) в соответствии с инструкциями производителя. ДНК элюировали в буфере Tris-EDTA (pH 8,0), и аликвоту использовали для амплификации ПЦР.Все образцы ДНК хранили при -20 ° С до проведения ПЦР-анализа. Для скрининга на инфекцию микоплазмой мы провели консенсусную ПЦР Mycoplasma с ДНК, выделенной из образцов носовых мазков, как описано ранее [14]. Вкратце, амплификацию области V3 рибосомальной ДНК 16S проводили с консенсусными праймерами GC-341F (5′-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGC AG-3 ‘) и 534GCTGAC (534GCTGAC) и 534GCTGAC (534GCTGAC). Матричную ДНК (50 нг) и 20 пмоль каждого праймера добавляли в пробирку для смеси ПЦР ( AccuPower PCR PreMix; Bioneer Corporation), содержащую 2.5 ед. ДНК-полимеразы Taq, 250 мкМ каждого дезоксинуклеозидтрифосфата, 10 мМ трис-HCl (pH 8,3), 40 мМ KCl, 1,5 мМ MgCl 2 и краситель для загрузки геля. Конечный объем доводили до 20 мкл дистиллированной водой. Реакционную смесь подвергали денатурации при 94 ° C в течение 5 минут, затем следовали 30 циклов при 95 ° C в течение 1 минуты, 55 ° C в течение 45 секунд и 72 ° C в течение 1 минуты и на заключительном этапе наращивания при 72 ° C в течение 10 минут, и образцы хранились при 4 ℃ до анализа. Реакции проводили с использованием My Genie 32 Thermal Block PCR (Bioneer Corporation).Восемь микролитров каждого образца смешивали с 2 мкл загрузочного буфера и разделяли электрофоретически на 1,2% агарозных гелях, окрашенных 0,5 мкг / мл бромистого этидия. Полосы ДНК наблюдались в ультрафиолетовом свете. Для идентификации собак Mycoplasma разновидностей мы использовали видоспецифические реакции ПЦР для M. arginini , M. canis , M. cynos , M. edwardii , M. felis , M. gateae , M. maculosum , M.molare , M. opalescens , M. spumans и Mycoplasma sp. HRC 689. Из-за высокого сходства генов 16S рРНК у собак Mycoplasma видов [15], видоспецифичные ПЦР-тесты для областей, идентифицированных в межгенной спейсерной области 16S / 23S рРНК, были разработаны для видов Mycoplasma [15]. 16]. Реакции ПЦР проводили с прямым праймером (Myc1; 5′-CACCGCCCGTCACACCA-3 ‘) и следующими обратными праймерами: M. arginini (5′-GTTGTATGACCTATTGTTGTC-3′), M.canis (5′-CTGTCGGGGTTATCTCGAC-3 ‘), M. cynos (5′-GATACATAAACACAACATTATAATTG-3′), M. edwardii (5′-CTGTCGGGTTATCATGCGA M. ‘-GGACTATTATCAAAAGCACATAA C-3’), M. gateae (5′-GTTGTATGACCTATTGTTGTC-3 ‘), M. maculosum (5′-CCTATGATTGTTACAGATTTG-3′), GAT- 3 ‘), M. opalescens (5′-TAAGCTTTGTAGACCATAA-3′), M. spumans (5′-GTTGTATGACCTATTGTTGTC-3 ‘) и Mycoplasma sp.HRC 689 (5′-CTTGCGACCTA ACAAGTCC-3 ‘) [16]. Кроме того, мы провели видоспецифическую ПЦР для обнаружения M. collis с использованием праймера 1 (5′-AAAAGAAGCTTGAATTATAG-3 ‘) и праймера 2 (5′-ATTAAGAGTCATTTCCTACT-3’) [17]. Все ПЦР начинались с начальной денатурации при 95 ° C в течение 5 минут, после чего следовала конкретная стадия отжига, а затем — окончательное удлинение при 72 ° C в течение 5 минут. Реакции ПЦР выполняли с каждым 25 пмоль прямого и обратного праймеров, и матричная ДНК (50 нг) добавлялась в пробирку для смеси ПЦР ( AccuPower PCR PreMix; Bioneer Corporation), содержащую 2.5 ед. ДНК-полимеразы Taq, 250 мкМ каждого дезоксинуклеозидтрифосфата, 10 мМ трис-HCl (pH 8,3), 40 мМ KCl, 1,5 мМ MgCl 2 и краситель для загрузки геля. Конечный объем доводили до 50 мкл дистиллированной водой. Реакции проводили с использованием My Genie 32 Thermal Block PCR (Bioneer Corporation). Восемь микролитров каждого образца смешивали с 2 мкл загрузочного буфера и разделяли электрофоретически на 1,2% агарозных гелях, окрашенных 0,5 мкг / мл бромистого этидия. Полосы ДНК наблюдались в ультрафиолетовом свете.Грубые поражения серого или сливового цвета были обнаружены на легком собаки № 8, чаще всего в апикальных долях и долях сердца. Некоторые поражения демонстрировали четкую демаркацию и консолидацию. Микроскопические поражения были ограничены верхушечной и сердечной долями легкого. Консолидированные участки цвета сливы в инфицированных легких соответствовали легким и тяжелым характерным периваскулярным и перибронхиолярным лимфомононуклеарным узлам инфильтрации, часто сжимающим просвет бронхиол (рис. 1).Бронхиальный и бронхиолярный эпителий показали потерю ресничек на эпителиальных клетках и сползание эпителиальных клеток в просвет дыхательных путей. Проникающие лимфоциты и мононуклеарные клетки часто наблюдались вкраплениями между эпителиальными клетками. В просвете дыхательных путей наблюдались отечная жидкость, нейтрофилы и крупные мононуклеарные клетки. Лимфоидные узелки были связаны с сужением просвета дыхательных путей. Наблюдались перибронхиолярная лимфоидная гиперплазия и утолщение интерстициальной ткани, патогномоничные поражения микоплазменной пневмонии (рис. 1).Консенсусный метод анализа ПЦР с использованием рибосомальной ДНК 16S был использован для обнаружения микоплазм. Ген 16S рДНК (340 п.н.) специфически амплифицировали с помощью ПЦР с род-специфичными праймерами Mycoplasma (GC-341F и 534R). Фрагменты нуклеиновой кислоты-мишени специфически амплифицировали консенсусной ПЦР с праймерами рибосомной ДНК 16S. В результате микоплазма была обнаружена в образце мазка из носа собаки № 8 с помощью ПЦР (рис. 2). У здоровых собак микоплазм не обнаружено. Для идентификации вида собак Mycoplasma из легочной ткани собаки No.8, Mycoplasma проводили видоспецифические реакции ПЦР. Мы идентифицировали M. cynos путем положительной амплификации цепи ДНК длиной 227 пар оснований (рис. 3). Мы не обнаружили амплификацию во время ПЦР для M. arginini , M. canis , M. edwardii , M. felis , M. gateae , M. maculosum , M. molared , M. opalescens , M. spumans , Mycoplasma sp. HRC 689 или M.Коллис . Микоплазмы являются признанными возбудителями респираторных заболеваний у многих видов животных, включая человека. Обычно болезнь протекает в легкой форме, но было показано, что она предрасполагает хозяина к более тяжелой вторичной инфекции и обостряет сопутствующие инфекции [18]. Встречающийся в природе микоплазмоз — коварное заболевание, которое может существенно повлиять на исследования в различных дисциплинах в области медицины лабораторных животных, поскольку микроорганизмы могут широко распространяться среди хозяев [2].Известно, что незаметная инфекция влияет на физиологические механизмы и иммунную систему, тем самым влияя на экспериментальные результаты, полученные с зараженными животными [19]. Он изменяет как количество, так и субпопуляционное распределение лимфоцитов в легких [4], а также вызывает повышение активности NK-клеток, подавляя гуморальный ответ антител [20] и увеличивая продукцию TNF, IL-1, IL-6 и интерферонов [21]. ]. Инфекция микоплазмой лабораторных животных влияет на результаты биомедицинских исследований и может угрожать здоровью персонала, проводящего эксперименты на животных.Вспышка зоонозного вируса M. pneumoniae была зарегистрирована в группе студентов, у которых в классе была инфицированная семья сирийских золотых хомяков [22]. Недавно, видов Mycoplasma были признаны важными возникающими и вновь появляющимися патогенами при болезнях человека и животных [23]. Необходимо ответить на множество вопросов относительно инфекции Mycoplasma у людей и животных. Что касается лабораторных животных, то было идентифицировано видов Mycoplasma , которые, как было установлено, широко распространены в помещениях для животных [2].Мониторинг и контроль этих микоплазм необходимы для обеспечения оптимальных результатов экспериментов на лабораторных животных. Бактериальный посев — лучший метод диагностики бактериальной инфекции. Однако чувствительность метода выделения культур невысока [12]. Поэтому посев не считается наиболее практичным диагностическим инструментом. ПЦР — это специфический и чувствительный молекулярный метод обнаружения ДНК микоплазм, который может дополнять другие методы. Однако ПЦР с использованием видоспецифичных праймеров может потребовать нескольких анализов из-за присутствия ряда видов Mycoplasma [1].В этом исследовании консенсусная ПЦР успешно выявила ДНК микоплазмы в образце мазка из носа. Таким образом, консенсусная ПЦР может быть рекомендована для мониторинга видов Mycoplasma у лабораторных животных. Микоплазмы считаются потенциальными агентами респираторных заболеваний собак [8,24]. Некоторые авторы также описывают Mycoplasma collis как микоплазму собак [25]. Однако мы не можем найти никаких сообщений об инфекции M. collis у собак, и отчеты указывают на то, что этот вид был первоначально изолирован от грызунов [26]; следовательно, этот вид мог быть ошибочно идентифицирован как имеющий собачье происхождение.Кроме того, в других публикациях описывается выделение нетипированных Mycoplasma spp. от собак [11, 27]. За последние 20 лет работа с микоплазмами собак была чрезвычайно ограничена, и было опубликовано всего лишь несколько публикаций о микоплазмах собак. M. cynos был выделен от 2 собак в питомнике с пневмонией [9], и было показано, что он вызывает пневмонию с тяжелым воспалением бронхов и тканей дыхательных путей [8]. На сегодняшний день имеется ограниченная информация об этиологической роли микоплазм в естественных заболеваниях собак [5,6,8,9].Однако теперь показана связь между M. cynos , выделенным из нижних дыхательных путей, и тяжестью инфекционного респираторного заболевания у собак, содержащихся в питомнике [15]. Только M. cynos был достоверно связан с респираторным заболеванием. Некоторое время известно, что микоплазмы модулируют восприимчивость хозяина к вторичным инфекциям [18,28]. Таким образом, можно подозревать присутствие других инициирующих агентов и вовлекать микоплазменные агенты. М.cynos был изолирован от собак с пневмонией [8,9,29] и был особенно распространен в наиболее некротизированных областях легкого [29]. Более того, M. cynos был единственным агентом, обнаруженным во вспышке тяжелой бронхопневмонии в помете молодых щенков, которая привела к нескольким смертельным исходам, но исчезла у выживших однопометников после введения соответствующих антибиотиков [30]. Экспериментальная эндобронхиальная инокуляция собак M. cynos вызвала локализованную пневмонию с деструкцией и потерей ресничек бронхиального эпителия и альвеолярной инфильтрацией нейтрофилами и макрофагами [10], а в нашем исследовании — M.cynos был обнаружен в легочной ткани с помощью ПЦР. Известно, что M. cynos может сохраняться в легких в течение 3 недель после заражения [10], и что он также может быть выделен из трахеи, конъюнктивы, миндалин и даже собачьих аэрозолей [16,31]. Способность M. cynos сохраняться в окружающей среде неизвестна, но другие виды Mycoplasma могут выживать от недель до месяцев вне хозяина, и поэтому окружающая среда может быть источником инфекции [32].Недавно было показано, что образование биопленок важно для устойчивости микоплазм и может способствовать выживанию в окружающей среде [33], и кажется возможным, что M. cynos может сохраняться в окружающей среде питомника в виде прилипшего слоя биопленки. M. cynos был первоначально выделен во время вспышки энзоотической пневмонии у собак в питомнике, когда 2 здоровые собаки контактировали с инфицированным пометом [9]. В нашем исследовании M. cynos было идентифицировано из легких собаки с респираторным заболеванием.Инфекция M. cynos могла предшествовать или замещаться инфекцией другим микроорганизмом. Предыдущее исследование показало, что большее количество бактерий было выделено от собак с более тяжелым клиническим заболеванием [34], и это могло затруднить выделение M. cynos из-за увеличения числа других бактериальных колоний, растущих на среде. . В таких случаях использование видоспецифической ПЦР Mycoplasma непосредственно на клинических образцах или фильтрация образцов через 0.Фильтр 2 мкм перед нанесением покрытия может улучшить обнаружение M. cynos .

В этом исследовании мы встретили лабораторную собаку породы бигль с респираторным заболеванием и провели медицинское обследование колонии из 20 собак породы бигль в помещениях для лабораторных животных. Микоплазма была обнаружена у собаки с респираторными симптомами с помощью консенсусной ПЦР-анализа, а у здоровых собак микоплазма обнаружена не была. Пораженная собака была усыплена. При патологоанатомическом исследовании на легких были обнаружены патологические поражения серого или сливового цвета, чаще всего присутствующие в апикальных долях и долях сердца.Некоторые поражения демонстрировали четкую демаркацию и консолидацию. Микроскопические поражения ограничивались апикальной и сердечной долями легкого. Консолидированные участки сливового цвета в инфицированных легких соответствовали легким или тяжелым характерным периваскулярным и перибронхиолярным лимфомононуклеарным узлам инфильтрации, часто сжимающим просвет бронхиол. Наблюдались перибронхиолярная лимфоидная гиперплазия и утолщенные интерстициальные образования, которые известны как патогномоничные признаки микоплазменной пневмонии.Для идентификации видов Mycoplasma свежие ткани были отправлены на видоспецифический ПЦР-анализ, и было идентифицировано M. cynos .

Консенсусная ПЦР может успешно обнаруживать микоплазмы и была рекомендована для мониторинга видов Mycoplasma у лабораторных животных [14]. В этом исследовании для обнаружения микоплазмы у лабораторных собак породы гончая использовалась консенсусная ПЦР. Результаты показывают, что консенсусная ПЦР может быть полезной и эффективной для мониторинга видов Mycoplasma у различных видов лабораторных животных, включая грызунов и собак.Применение консенсусной ПЦР перед видоспецифической ПЦР было бы лучшей стратегией для обнаружения и идентификации видов Mycoplasma .

Это роль в репродуктивных заболеваниях — Справочный центр Комитета здравоохранения PBGVCA

Дженис Кейн, DVM и
Мелисса Гудман, DVM

( Источник: Новости International Canine Genetics, Inc., февраль 1994 г., стр. 1, 4. )

Инфекции микоплазмы считаются причиной бесплодия как у сук, так и у кобелей-производителей.В результате микоплазма продолжает привлекать внимание как потенциальная проблема для заводчиков чистокровных собак. В следующей статье обсуждается то, что в настоящее время известно об инфекциях микоплазм у собак, и излагается подход к ведению племенных животных.

ЧТО ТАКОЕ МИКОПЛАЗМА?
Микоплазмы — это бактериальные организмы, которые из-за своего чрезвычайно малого размера были помещены в отдельный класс. Кроме того, в отличие от любых других бактерий, у микоплазм отсутствует жесткая клеточная стенка, что делает их невосприимчивыми к действию антибиотиков, вызывающих повреждение клеточной стенки (например, пенициллина).Микоплазмы — чрезвычайно требовательные организмы, которые трудно культивировать без специальных сред, и даже в этом случае их может быть трудно восстановить. Уреаплазмы — это особый тип микоплазм, которые были разделены на подклассы и идентифицированы по своему собственному названию.

МИКОПЛАЗМА КАК ЧАСТЬ НОРМАЛЬНОЙ ФЛОРЫ
Было обнаружено, что несколько видов микоплазм являются нормальными обитателями верхних дыхательных и половых путей собак и кошек, и в результате их можно регулярно выделять из полости рта, носа, конъюнктивы и гениталий. слизистые оболочки.Несколько исследований специально изучали частоту восстановления микоплазм из половых путей фертильных и бесплодных сук и кобелей-производителей, и не было обнаружено значительных различий. (1,2) Таким образом, извлечение микоплазмы из влагалища или спермы не всегда коррелирует с репродуктивным заболеванием, и также не всегда требует лечения. Поскольку эти организмы существуют в дыхательных путях, а также в репродуктивных путях, передача аэрозоля от собаки к собаке (воздушно-капельным путем.облизывание, обнюхивание и т. д.), вероятно, встречается чаще, чем венерическая передача.

КОГДА БЕСПОКОИТЬ МИКОПЛАЗМУ?
Хотя микоплазмы могут быть нормальными обитателями репродуктивного тракта, они связаны с бесплодием, поражениями репродуктивных путей и аномалиями сперматозоидов. (3.4.5) Как и в случае со многими условно-патогенными микроорганизмами (организмами, которые могут вызывать заболевание, но часто не вызывают), клиническое заболевание часто возникает, когда животное находится в состоянии стресса и / или подвергается воздействию большого количества организмов.Близкие интенсивные условия содержания (например, в большом питомнике или на выставках собак в помещении) предоставляют возможность для развития большого количества организмов. Однако здоровая собака или сука, особенно при индивидуальном содержании, не может заболеть даже после известного контакта с организмом.

Было обнаружено, что прием антибиотиков широкого спектра действия может подавлять многие другие бактерии, составляющие нормальную флору, и позволять микоплазмам разрастаться. Следовательно, профилактическое использование антибиотиков перед скрещиванием не рекомендуется, поскольку оно может фактически создать патогенное состояние и может способствовать развитию устойчивых к антибиотикам популяций организмов.

Посев на микоплазмы следует проводить, если:

1) Кобель пропустил несколько сук (т. Е. Отсутствие зачатия).
2) Оценка спермы показывает морфологически аномальные сперматозоиды.
3) Сука не зачала от плодовитого кобеля в подходящие дни.
4) Собака или сука производит зачатие, но у них документально подтверждена высокая скорость рассасывания плода.

Важно помнить, что существует множество других причин вышеуказанных проблем, поэтому посев на микоплазмы должен быть только частью тщательного диагностического исследования, проводимого ветеринаром, имеющим опыт репродукции собак.

ПРАВИЛЬНЫЙ МЕТОД КУЛЬТУРЫ МИКОПЛАЗМЫ
Из-за своей требовательной природы микоплазмы требуют специальных методов для успешного выращивания в культурах. В результате культуры микоплазм следует отправлять только в лаборатории, компетентные в восстановлении организма. Рекомендуется одновременно культивировать уреаплазму, поскольку это похожий организм, который также был замешан в инфекциях репродуктивного тракта. (1)

Правильная техника получения образца для культивирования также чрезвычайно важна.У сук рекомендуется брать пробы из области влагалища, близкой к шейке матки, с помощью тампона под защитой. У кобелей-производителей важно, чтобы образец спермы был собран с использованием стерильной техники, избегая контаминантов уретры.

ЧТО ДЕЛАТЬ С ОБЫЧНЫМИ ФЕРТИЛЬНЫМИ СОБАКАМИ И СУКАМИ!
Поскольку микоплазма часто выращивается из влагалища нормальных фертильных сук, рутинные предварительные посевы сук не требуются. Поскольку микоплазма часто выделяется из посевов крайней плоти и / или спермы нормальных фертильных самцов, обычные предварительные посевы могут показать некоторый рост микоплазмы как части нормальной флоры.Однако некоторые владельцы могут выбрать периодическое культивирование спермы собаки на микоплазму.Хотя отрицательный результат является окончательным, значимость положительного результата всегда должна определяться корреляцией с оценкой спермы и клиническим состоянием. К сожалению, фертильность собаки не может быть определена на основе восстановления микоплазмы.

РЕЗЮМЕ
Инфекция микоплазмой — лишь один из многих факторов, которые могут повлиять на фертильность собак. Работа с опытным ветеринаром с тщательным и систематическим подходом к исследованию проблем фертильности принесет дивиденды вашей программе разведения.

Защищенный тампон, рекомендованный для правильного вагинального культивирования у сук, доступен через TCG. Ветеринары могут заказать систему сбора / транспортировки образцов Accu-CulShure®, позвонив в TCG по телефону 800-248-8099.

1. Doig PA, Ruhnke HL, Bosu WTK: генитальная микоплазма и флора уреаплазмы здоровых и больных собак. Can J Comp Med 45: 233, 1981.

2. Бьюрстром Л., Линде-Форсберг К.: Долгосрочное исследование аэробных бактерий половых путей у племенных собак, Am J Vet Res 53: 670-673, 1992.

3. Lein DH: Mycoplasma бесплодие у собак: диагностика и лечение. Proc SFT, сентябрь 1989 г., стр. 307-313.

4. Хольцманн А., Лабер Г.: экспериментально индуцированная микоплазменная инфекция половых путей кобеля. Therio 7 (4): 167-188, 1977.

5. Lingwood CA et al: Общий рецептор сульфогликолипидов для микоплазм, вызывающих бесплодие животных и человека. Биол Репродук 43: 694-697, 1990.

Добавить комментарий

Ваш адрес email не будет опубликован.