Щенки шпицы: Наш сайт временно недоступен

Содержание

чем кормить и как ухаживать, а также что нужно для малыша и его здоровья

Шпицы – одна из узнаваемых в мире пород собак. Рыжие, похожие на лисиц, любопытные собаки мелкого роста мгновенно способны завоевать сердца любителей животных, что делает эту породу популярной для содержания в городских квартирах.

Самый популярный вид шпица – померанский. Выведен он, целенаправленно – как декоративная собака.

Эта порода собак ведет историю из Германии, где на протяжении веков, шпицы, крупные по размеру, становились помощниками пастухов. До 18 века никто не выращивал мелких представителей, но пришедшая к породе популярность дала толчок к разведению собак.

Знатные люди той эпохи держали шпицев (ценным считался вес до 6 кг) как декоративных. В 20 веке собаки через Сибирь и Китай попали в Японию, где был выведен белый японский шпиц. Выбор щенка кажется простым, но на деле надо, конечно же, смотреть родословную.

Как выбрать щенка померанского шпица?

Стоит заметить, что стандарт шпицев обширен, если говорить о цвете собак. Важна однотонность — щенок должен быть рыжим или белым. Если вам хотите черного с подпалом, зонарного окраса, то стоит искать такого в питомниках, специализирующихся на данной расцветке.

Важно! Истинный цвет шпица станет понятен только после линьки, но примерный окрас угадывают по цвету шерсти за ушами щенка. Взрослая собака не линяет.

Подойдите к выбору серьезно: спросите у заводчика родословную (для понимания, какого цвета будет пес во взрослом состоянии), свяжитесь с теми, кто брал щенков из предыдущих поколений.

Также у собаки из питомника есть паспорт и свидетельство с вписанными туда прививками. Если рассматривать физический фактор, то щенок должен быть бодрым и любопытным. Расцветка шпица не влияет на характер собаки.

Не менее важен и вопрос кормления щенка. Обычно прикорм малышам начинают давать в возрасте 7 недель, а то и раньше.

Заводчик сразу переводит щенка на сухой корм или же держит на натуральном питании.

Совет! Помните, что шпиц – активная собака! Гулять с ней нужно по 2 раза в день в течение часа или двух. Если вы не готовы к этому и хотите, чтобы животное не покидало пределы комнаты, заведите более мелкую породу.

Чем и сколько лучше кормить щенка

Если померанец с месячного возраста приучен к сухим кормам, то не стоит менять систему питания, так как в кормах, разработанных специально для таких небольших пород, содержится весь набор микроэлементов и витаминов.

Давать дополнительные витамины шпицу не нужно, если только после визита к ветеринару это не было предписано в связи с какими-либо факторами.

В дополнительных овощах или фруктах собака не нуждается, но если вы хотите дать ей в качестве игрушки (для того, чтобы точить зубы) морковь или яблоко, и животное с удовольствием грызет их,

натуральный прикорм в минимальном количестве не повредит.

Если же малыш содержался на натуральном питании, то стоит узнать у заводчиков, чем его кормили и придерживаться такого же меню.

Продукты, которые дают шпицам, следующие: курица, нежирная говядина, морская рыба, субпродукты, вареные яйца, творог, сыр, кефир, рис, гречка, геркулес и собачьи галеты. Мясо отваривают или ошпаривают в кипятке, из рыбы вынимают кости и еще готовят лакомство своими руками.

Запрещенные продукты: сладости, конфеты, копченое, соленое, бобовые, картофель, макароны, хлебобулочные изделия, пшено, перловая крупа, манная каша, любые кости.

Совет! Собакам нельзя давать никакие кости, в том числе куриные, мягкие и т. д. Щенок может легко подавиться. Единственное исключение – большие говяжьи мослы, которые предварительно отваривают. Такие кости полезны для зубов, которые чешутся при смене молочных на постоянные.

Важное правило – старайтесь кормить собаку в одно и то же время. По количеству кормлений нужно придерживаться тех же правил, что действуют для остальных пород: щенков в возрасте до 2 месяцев кормят 6 раз в день, в 3-4 месяца – 4 раза в день, в возрасте с 5 до 8 месяцев – 3 раза в день, а после 8-9 месяцев – 1-2 раза в день.

Не балуйте шпица, который будет просить еду со стола – она ему запрещена, чтобы не возить животное по врачам. Мелкие породы — шпицы имеют слабую поджелудочную железу, поэтому выбор правильного питания первостепенен.

Что нужно для щенков померанского шпица

Если вы твердо решили завести померанского шпица, то вам потребуются немалые расходы еще до того, как малыш попадет к вам в дом.

Вам потребуются:

  • Устойчивая, тяжелая по весу посуда, из которой щенок будет есть и пить.
  • Расчески двух видов: пуходерка (массажная щетка) и железная расческа с длинными редкими зубьями.
  • Лежак (корзинка) для собаки или вольер (если вы планируете оставлять собаку одну надолго).
  • Переноска, в которой щенка возят к ветеринару или в загородные поездки.
  • Игрушки (резиновые без пластмассы, плюшевые, специальные из зоомагазинов).
  • Комбинезон, в котором померанец будет гулять в грязную или дождливую погоду.
  • Ошейник (нейлоновый или из мягкой кожи) и поводок.
  • Собачьи шампуни, кондиционеры и спреи для облегчения расчесывания шерсти.
  • Лоток, куда щенок будет ходить до того момента, когда ему сделают первые прививки, и пройдет период карантина (две недели после прививок).
  • Спреи, ошейники, капли или шампуни от клещей.
  • Ножницы с закругленными кончиками или когтерезка для подстригания коготков собаки.
  • Фен специальный для собак (из зоомагазина) или же имеющий режим подачи теплого воздуха.

Так выглядит примерный набор того, что вам понадобится для правильного содержания данной породы.

Кроме того, перед тем, как животное будет доставлено в новый дом, следует проверить все углы на предмет наличия там мелкого мусора, который будет проглочен любопытным питомцем.

Лежак следует оборудовать не в коридоре или на кухне, а в зале или спальне – там, где спокойно.

Приучать к вольеру следует постепенно, заманивая шпица туда игрушками или собачьими лакомствами.

Комбинезон у такой пушистой породы должен быть по той причине, что купать часто собак нельзя, а грязи, даже после одной прогулки шпиц соберет немало.

Важно! Нельзя держать шпица в вольере, если вы дома и не спите. Собака должна много двигаться. Постоянное запирание в клетке сформирует нервный характер, что будет сопровождаться постоянным лаем.

Первые дни в новом доме

Шпицы – очень жизнерадостные собачки, поэтому они быстро привыкнут к вам, тем более, если вы окружите их лаской и заботой. Принеся малыша в дом, дайте ему время освоиться – пусть он обойдет все углы, обнюхает.

Не берите собаку на руки лишний раз.

 Совет! Возьмите у заводчика предмет (игрушку, тряпку), имеющий запах, к которому померанец привык, и положите его в лежак. Когда малыш уснет в любом месте, перенесите его в лежак.

Старайтесь первые дни держать шпица под наблюдением, чтобы понимать, нравится ли ему в новом доме, хорошо ли он питается.

С первых дней необходимо приучать эту породу к расчесыванию и лотку. Если вы не хотите, чтобы животное спало с вами, не берите его в свою кровать ни при каких обстоятельствах. Да, он милый, но пару раз поспав на диване или кровати, он будет протестовать против других мест для сна.

Дрессировка

Порода легко поддается дрессировке, но важно помнить, что собака имеет доминантный характер. Своего добиваться любит и умеет – чаще всего лаем. Поэтому нужно отучить лаять по каждому поводу, не идти на поводу у капризных шпицев.

Совет! Уделяйте любимцу как можно больше времени и постоянно учите новые команды, не забывая повторять уже выученные. Тогда щенок не будет стремиться облаять всех на улице, а будет понимать, чего от него хотят.

Уход за щенком померанского шпица

Несоблюдение простых требований гигиены сделает собаку неопрятной и раздражительной, поэтому приучать к постоянному расчесыванию или стрижке нужно с первых недель пребывания в доме.

Гигиена

Главное – расчесывать померанского шпица. В идеале это делают по 5 – 10 минут ежедневно с помощью расчески с редкими зубьями.

Важно приучить к этой процедуре своенравную собаку. Если не получается делать это каждый день, то 3 раз в неделю тоже достаточно, и на внешнем виде это не отразится. Шерсть померанцев имеет густой подшерсток, который легко скатывается в колтуны без постоянного ухода и груминга.

Приучать к лотку животное нужно с первых дней содержания дома. Малыша относят к лотку с пеленкой, как только он проснулся или покушал. Через несколько дней (недель) собака поймет, что ходить в туалет нужно туда.

Важно! В грязную погоду шпица выгуливают в комбинезоне, так как купать чаще, чем раз в месяц его нельзя.

Прогулки

Маленьких щенят приучают к улице через две недели после окончания карантина, связанного с вакцинацией.

Гуляют сначала по 10 минут 2 раза в день. Постепенно время выгула увеличивают до двух часов 2 раза в день. Не все хозяева могут позволить себе тратить столько времени на прогулки с питомцем, поэтому животное должно проявлять активность дома, то есть запирать в комнате его запрещено.

Важно! На выгулах обязательно держите малыша на поводке. Если вокруг нет людей, то выпускайте на свободный выгул, но отслеживайте, чтобы щенок не потерялся.

Купание и стрижка

Купать померанцев можно раз в 1 – 3 месяца. Предварительно собаку спрыскивают спреем для облегчения расчесывания, тщательно вычесывают, потом купают специальным шампнунем, применяют кондиционер. Расчесывание после купания должно быть аккуратным и тщательным.

Купать во время линьки шпица запрещено. Иначе это испортит шерсть, так как остевые волосы (наружный слой), которые должны быть жесткими и торчащими, станут мягкими и начнут виться.

Совет! Шпица нужно сушить феном, так как без этой процедуры он может простудиться или в шерсти заведется грибок. Собаку вытирают полотенцем и тщательно высушивают, начиная с лап и заканчивая боками и спиной. Высушивают, отделяя небольшие участки шерстки.

Здоровье щенков шпица: прививки и вакцинация

Как и любой породе собак, шпицу необходимы прививки. Когда щенков отлучают от матери, их глистогонят, а после делают первую прививку (в 1,5 – 2 месяца). Следующая вакцинация происходит через 2 – 4 недели после первой. В течение 10 – 14 дней собака находится на карантине и не гуляет на улице, а после можно смело выносить щенка на прогулки.

Совет! Если вы выгуливаете шпица весной, то обработайте его от клещей! Накапайте на холку капли, которые посоветует ветеринар, либо купить специальные шампуни или ошейник. После прогулок тщательно осматривайте собаку на наличие паразитов. В случае обнаружения клеща немедленно отправляйтесь к ветеринару.

Таблица роста и веса щенков померанского шпица по месяцам

Вес щенков при рождении (в граммах)

Месяц Неделя 70 – 80 90 – 100 110 – 120 125 – 140 145 – 170
1 2 145 – 160 180 – 200 210 – 250 280 – 350 370 – 410
4 200 – 230 250 – 310 330 – 370 450 – 550 560 – 650
2 6 250 – 320 330 – 420 430 – 470 550 – 670 670 – 850
8 310 – 370 430 – 550 550 – 600 650 – 820 860 – 1050
3 10 370 – 450 540 – 630 650 – 700 790 – 960 1050 – 1200
13 460 – 580 670 – 800 800 – 900 1000 – 1300 1400 – 1550
4 15 550 – 650 750 – 900 900 – 1050 1100 – 1450 1450 – 1700
17 600 – 750 850 – 1000 1000 – 1170 1300 – 1600 1700 – 1900
5 19 650 – 820 960 – 1100 1100 – 1300 1400 – 1750 1900 – 2100
21 700 – 800 1000 – 1250 1250 – 1400 1500 – 1850 2000 – 2200
6 23 750 – 950 1000 – 1300 1300 – 1500 1600 – 2000 2200 – 2400
26 750 – 980 1100 – 1300 1300 – 1600 1700 – 2100 2200 – 2500
1,5 года 1000 – 1300 1400 — 1700 1700 — 2000 2100 — 2500 2700 – 3000
Карликовый Маленький Средний Большой

Данные, приведенные в таблице, приблизительны, поэтому стоит ориентироваться на аппетит и общее самочувствие щенка.

Из всего вышесказанного следует, что померанский шпиц хоть и требует постоянного ухода, но не больше чем за другими мелкими породами. Главное, кормить собаку полезными для развития и роста продуктами, соблюдать правильный режим кормления, много гулять и уделять пушистому питомцу как можно больше времени.

Полезное видео

Видеоролик о щенках померанского шпица и об уходе за ними:

воспитание и уход с фото и видео

Щенки померанского шпица имеют свои особенности не только во внешности, но и в характере. Остановив свой выбор на этом щенке, нужно заранее определиться, где вы его будете содержать, как ухаживать и воспитывать, какие делать прививки. Для воспитания померанского шпица понадобится много сил и времени. Прежде чем привести померанского шпица домой, необходимо подготовить помещение, приобрести необходимые предметы для ухода. Обо всех тонкостях воспитания, содержания и ухода за щенком померанского шпица читайте в этой статье.

Подготовка помещения

Пока вы еще не привезли щенка померанского шпица к себе домой, нужно заранее обезопасить свой дом. Для этого необходимо сделать следующее:

  • уберите все провода, щенок померанского шпица очень любит грызть все подряд;
  • закройте все возможные щели, например, под диваном или шкафом — обследуя новую территорию, миниатюрная собака может спрятаться где угодно;
  • если вы живете в квартире, обязательно обезопасьте балкон, щенок померанского шпица может упасть с него;
  • все неустойчиво стоячие предметы лучше убрать, чтобы они не упали на малыша;
  • скользкие участки пола лучше укрыть коврами, чтобы щенок не повредил лапки;
  • все мелкие предметы также стоит убрать, иначе питомец может ими подавиться;
  • спрячьте все химические вещества – любопытный малыш может отравиться, например, средством для мытья посуды;
  • спрячьте ведро с мусором во избежание отравления щенка опасными для его здоровья вещами.

Подготовка места

Чтобы щенок померанского шпица сразу привык к своему месту, нужно заранее подготовить ему уголок. Место для сна не должно находиться возле отопительных приборов или, наоборот, там, где сквозняки. Вы не должны мешать друг другу, поэтому место для питомца не должно находиться на проходе. Наилучшее место для щенка померанского шпица – это ваша спальня, там он не будет чувствовать себя одиноко.

Померанский шпиц – порода маленькая, так что для лежанки подойдет специальный домик или корзинка, которые можно приобрести в любом зоомагазине. Туда необходимо положить небольшой матрасик и запастись сменными наволочками.

Если вы планируете иногда оставлять малыша одного, то лучшим вариантом будет специальный небольшой бокс или вольер, чтобы он не смог себе навредить, пока вас нет рядом. Приучать к месту щенка померанского шпица стоит постепенно, подкладывая туда лакомства или любимые игрушки.

Но постоянно держать малыша в вольере нельзя – ему необходимы пространство и активные игры, выпускайте его побегать как можно чаще.

Перевозка щенка

Как только вы получили щенка на руки со всеми документами и больничным листком, в котором содержится информация о сделанных прививках, можно ехать домой. Перевозить малыша нужно аккуратно. Желательно завернуть его в мягкое полотенце и держать на руках. Щенок еще слишком маленький и, скорее всего, боится перемен – на руках у хозяина он легче перенесет смену обстановки.

Первый день

Приехав домой, стоит сразу же поставить малыша на пол и дать ему привыкнуть к новой обстановке. Брать его на руки без нужной необходимости нельзя. Естественно, питомец будет напуган, поэтому разговаривайте с ним спокойным и ласковым тоном, чтобы внушить ему чувство уверенности.

В первую же ночь оставьте щенка на его месте с кормом и достаточным количеством воды. После того, как он исследует территорию, закройте малыша на всю ночь.

Основы содержания

После того, как щенок померанского шпица поселился в вашем доме, необходимо правильно ухаживать за ним, вовремя делать прививки и прогон глистов, с первых дней воспитывать его. Соблюдая все правила по уходу за собачкой, вы сможете вырастить воспитанного и преданного вам питомца.

Чистоплотность щенка

Маленький щенок похож на грудного ребенка, поэтому первое время он будет справлять нужду часто и где придется. Не нужно ругать за это. Лучше понаблюдайте за ним: как только малыш начнет крутиться на одном месте, сразу же отнесите на заранее подготовленное место, где нужно положить пеленку или газеты.

Обычно щенки справляют естественную нужду после сна или приема пищи. Несколько дней такого воспитания — и ваш щенок отблагодарит вас тем, что перестанет повсюду оставлять лужи и кучки.

Режим кормления

Вместе с листком о проделанных прививках вы должны получить инструкцию кормления, где будет описано, что и как ел ваш щенок померанского шпица у заводчика. Это очень важный момент, ведь если сразу сменить корм, то есть риск расстройства желудка у питомца, вследствие которого наступает резкое обезвоживание организма.

Лучший вариант для щенка померанского шпица – это сухие корма, в которых правильно сбалансированы все необходимые витамины, минералы и биологически активные вещества, необходимые для правильного физического развития организма собаки.

Если вы решили сами готовить для своего питомца, то проконсультируйтесь с ветеринаром. Он посоветует подходящую вашему малышу естественную диету.

Шерстяной покров

Уход за шерстью померанского шпица прост: достаточно расчесывать ее три раза в неделю и стричь по мере необходимости, чтобы питомец выглядел опрятно.

Раз в месяц щенка померанского шпица можно купать собачьим шампунем, приобрести который вы сможете в любом зоомагазине.

Зубы щенка

Такой маленькой собаке, как померанский шпиц, зубы обычно доставляют много проблем. Чтобы избежать зубных заболеваний, нужно два раза в неделю чистить зубы питомца специальной пастой или зубным порошком.

Профилактика болезней

Чтобы избежать заражения вашего питомца какими-либо болезнями, нужно вовремя делать прививки, которые описаны в больничном листе. Помимо этого, время от времени консультируйтесь с ветеринаром по поводу необходимых прививок и прогона глистов в будущем.

Необходимые прогулки

В уход за щенком померанского шпица входит такой важный пункт, как прогулки. Как и любому животному, щенку просто необходим свежий воздух, особенно если он содержится в квартире.

Выходить на улицу вместе с малышом можно только после всех сделанных прививок. Для первых походов нужно выбирать хорошую погоду, без дождя и ветра. Начиная с нескольких минут, постепенно доведите продолжительность прогулки до двух часов.

Не забывайте – померанский шпиц очень активная собака, так что стоять на месте не получится.

Основы воспитания

Как только щенок померанского шпица появился у вас дома, необходимо одновременно с уходом начинать воспитывать питомца. Первым делом малышу нужно запретить делать то, что нельзя делать в будущем. Хвалите и поощряйте лакомством питомца за хорошее поведение и ругайте, если он сделал что-то недопустимое.

Особенности характера

Померанский шпиц – собака с большим умом, он все схватывает на лету, поэтому кричать или бить малыша категорически запрещено. Лучше всего уверенно и настойчиво дать понять питомцу, что вы от него хотите. Но позволять щенку померанского шпица какие-нибудь поблажки и идти у него на поводу не стоит – он быстро поймет, что может добиться чего угодно и будет этим пользоваться.

Заниматься воспитанием щенка этой породы нужно постоянно, нельзя делать перерывы или без повода баловать собаку. Иначе она быстро привыкнет и будет добиваться своего постоянным лаем. Если же вы не станете потакать капризам померанского шпица, он станет неуправляемым и агрессивным.

Заводя щенка померанского шпица, будьте готовы уделять ему постоянное внимание. Придется общаться и играть с малышом, иначе он начнет развлекать себя сам — будет грызть и рвать все подряд, постепенно превращаясь в неадекватного и злобного пса.

Особенности темперамента

У щенка померанского шпица крайне выражена черта доминантности. Поэтому, как собственник и охранник территории, он будет постоянно лаять на любой раздражитель его спокойствия.

Чтобы это не переросло в излишнюю агрессивность к окружающему миру, вам нужно вовремя останавливать питомца.

Основы дрессировки

Благодаря дрессировке, ваш щенок вырастет послушной и воспитанной собакой. С такой породой, как померанский шпиц, особых проблем с этим процессом не должно возникнуть. Щенки легко поддаются основам дрессировки, так как пытаются во всем угодить своему хозяину.

Уже в пять месяцев собака может усвоить основные команды, но процесс дрессировки, как и уход, должен быть регулярным, иначе малыш быстро все забудет.

В питомнике померанский шпиц получил базисные основы дрессировки, но это не значит, что теперь не нужно с ним заниматься. Первым делом приучите щенка к его кличке, и обязательно поощряйте, когда он начнет отзываться. Одновременно с этой командой питомец должен научиться таким важным командам, как «ко мне», «сидеть», «лежать», «рядом», «место».

Благодаря основам дрессировки, питомец сможет адекватно вести себя с чужими людьми и животными, не станет бегать за кошками или лаять на машины.

Об уходе за взрослыми собаками читайте в статье «Уход и содержание взрослых померанских шпицев».

Расскажите нам, как вы ухаживаете за своим щенком померанского шпица?

Объявления Сахалина

Все города

Южно-Сахалинск

Александровск-Сахалинский

Анива

Быков

Вахрушев

Горнозаводск

Долинск

Ильинский

Корсаков

Красногорск

Курильск

Макаров

Малокурильское

Невельск

Ноглики

Оха

Поронайск

Северо-Курильск

Смирных

Томари

Тымовское

Углегорск

Холмск

Чехов

Шахтерск

Южно-Курильск

Абакан

Анапа

Артём

Архангельск

Астрахань

Барнаул

Белгород

Бийск

Биробиджан

Благовещенск

Брянск

Ванино

Владивосток

Владикавказ

Владимир

Волгоград

Волжский

Вологда

Воронеж

Геленджик

Грозный

Дзержинск

Евпатория

Ейск

Екатеринбург

Иваново

Ижевск

Иркутск

Казань

Калининград

Калуга

Кемерово

Керчь

Киров

Кисловодск

Комсомольск-на-Амуре

Кострома

Краснодар

Красноярск

Курган

Курск

Липецк

Магадан

Магнитогорск

Махачкала

Москва

Мурманск

Набережные Челны

Находка

Нижневартовск

Нижний Новгород

Нижний Тагил

Новокузнецк

Новороссийск

Новосибирск

Омск

Орёл

Оренбург

Пенза

Пермь

Петрозаводск

Петропавловск-Камчатский

Пятигорск

Ростов-на-Дону

Рязань

Самара

Санкт-Петербург

Саранск

Саратов

Севастополь

Симферополь

Смоленск

Сочи

Ставрополь

Стерлитамак

Сургут

Таганрог

Тамбов

Тверь

Тольятти

Томск

Тула

Тюмень

Улан-Удэ

Ульяновск

Уссурийск

Уфа

Хабаровск

Чебоксары

Челябинск

Череповец

Чита

Якутск

Ялта

Ярославль

Как выбрать щенка померанского шпица — советы от Питомника IMPERIAL FAMILY! | Питомник

Померанский или, как его ещё называют, карликовый шпиц, является, в первую очередь, очень красивой и обаятельной собакой. Представители этой породы всегда преданы своим хозяевам, но не навязчивы. Померанцы в буквальном смысле наполняют пространство вокруг себя позитивом. Ещё они отличаются сообразительностью, ласковы по отношению к другим животным, славятся дружелюбным и покладистым характером. Питомцы легко поддаются дрессировке, а обучать их одно удовольствие.

Щенки тонко чувствуют психологическое и эмоциональное состояние человека. Они рано начинают замечать, насколько счастливы окружающие, когда пушистая собачка ходит на одних задних лапках и с удовольствием демонстрируют это умение. В общем, если решили купить такого питомца, то однозначно не пожалеете. Важно лишь знать, как выбрать щенка померанского шпица, чтобы вам достался действительно элитный четырёхлапый друг.

Определяемся с целью покупки животного

В первую очередь необходимо определиться с целью приобретения. Почему это имеет значение? Во-первых, это в значительной мере определяет ваш будущий образ жизни. Ищете простого домашнего любимца? А может быть, мечтаете, чтобы элитный щенок вырос знаменитым чемпионом? В зависимости от того, зачем нужна собака, соответственно, предстоит наслаждаться жизнью и общением с питомцем, покорять выставки или посвятить своё время созданию потомства щенков. Животные «для души», шоу-класса или же для разведения существенно разнятся в стоимости.

Возраст щенка

Любой порядочный заводчик не станет продавать питомца в возрасте младше двух месяцев, а лучше – трёх. До этого времени щенки имеют слабый иммунитет и велика вероятность, что они могут заболеть.

Продажа животного в раннем возрасте опасна для его психического здоровья. Также чем старше собачка, тем понятнее, какой она вырастет. Крохотный щенок не в состоянии самостоятельно кушать, поэтому его приобретение чревато проблемами с питанием и с туалетом.

Щенки шпица от заводчика — spitzburg.ru

Самые почитаемые  жители Шпицбурга — это наши собачки: Умка, Люся и Плюша. Познакомиться с ними Вы можете на этой странице.

Дата рождения:07 декабря 2014

Пол:Девочка

Окрас:Оранжевый

 

Родители:Отец: Snow man
 Мать: Цветок любви Лач Грейс

История породы шпиц насчитывает уже несколько столетий. Принято считать, что давними предками современного шпица были северные ездовые собаки. Именно от них шпицу передалась выносливость и роскошная густая шерсть.

Первые собаки, завезённые в Европу, весили 13-14 кг. И только благодаря огромной многолетней селекционной работе кинологов-энтузиастов померанский шпиц приобрёл свой современный облик.


Согласно системе родословных FCI и РКФ немецкий шпиц подразделяется на несколько самостоятельных пород по ростовым характеристикам:

— миниатюрный (цверг) -18-22 см,
— малый (кляйн) — 23-29 см,
— средний (миттель) -30-38 см,
— большой (гросс) -42-50 см,
— кеесхонд -45-55 см.

По системе АКС, принятой в Америке, Канаде, Великобритании, порода называется померанский шпиц. Она была создана с целью уменьшения размера немецкого шпица, изменения типа головы и структуры шерсти, а также получения новых интересных окрасов с помощью скрещивания с собаками других карликовых декоративных пород.

Поскольку в России вязки между классическими немецкими и вывозными померанскими шпицами разрешены, это привело к появлению нескольких типов шпицев: всеми любимый «мишка», «лисичка», и промежуточный, а так же множество ростовых вариаций. Разнообразны и окрасы шпицев : чёрный, коричневый, оранжевый, кремовый, зонарно-серый, белый, пати-колорный (пятнистый) и др.

Принимая решение купить щенка шпица, стоит сначала ознакомиться с особенностями этой породы, чтобы понимать всё многообразие и выбрать подходящего именно для вас щенка.

В современном мире, в условиях мегаполиса тем более такого как Москва, не каждый может позволить себе завести собаку крупной породы. Тесные квартиры, часто отсутствие места для выгула, в конце концов недостаток свободного времени для длительны прогулок — все эти факторы всё чаще склоняют людей к выбору собак карликовых пород. И миниатюрный шпиц среди них по праву занимает одно из первых мест.

И это понятно. Несмотря на свой маленький размер, шпицы от природы обладают крепким здоровьем, устойчивой психикой и живым темпераментом. Эти собачки необыкновенно сообразительны и очень легко обучаются. Жизнерадостные, игривые и в то же время бдительные (маленький сторож).

Шпиц очень привязан к хозяину. Прекрасная собака-компаньон будет с радостью сопровождать вас и на прогулке, и в длительном путешествии. Благо, что взять с собой такую маленькую собачку не составит труда. Если же в плохую погоду у вас нет возможности погулять, тоже не проблема — карликовые шпицы легко приучаются к пелёнке.

Однако, прежде чем купить щенка померанского шпица, нужно трезво оценить свои возможности. Поскольку маленький щенок, как ребёнок, требует от хозяина много времени, внимания, терпения и очень ответственного отношения. Очень важно соблюдать режим кормления, вовремя делать прививки, защищать от паразитов.

Особенно стоит остановиться на уходе за шерстью шпица. Как уже было сказано выше, есть шпицы померанского и немецкого типов. Шерсть у них различается. У немецкого шпица шерсть имеет длинный прямой покровный волос и короткий густой подшёрсток, легко очищается сама, не требует частого мытья, не сваливается. Уход за ней совсем несложен и заключается в регулярном мытье и расчёсывании (особенно в период сезонной линьки). Шерсть померанца имеет меньше остевого волоса (иногда он совсем отсутствует), длинный ватоподобный подшёрсток и требует более тщательного ухода. Здесь без регулярных стрижек не обойтись.

Ещё хотелось бы остановиться на выборе размера вашего питомца. Многие мечтают приобрести совсем крошечную собачку. Но надо помнить о том, что чем мельче собака, тем более хрупкое у неё здоровье, тем более сложен уход за ней. Если вы к этому не готовы, не стоит брать щенка, который во взрослом состоянии будет весить меньше 2 кг. Это для гурманов и специалистов.


Итак, вы уже поняли, как велико разнообразие среди шпицев. И поэтому прежде, чем купить шпица у заводчика или в питомнике, задайте ему все интересующие вас вопросы, чтобы не разочароваться. Добросовестный заводчик всегда поможет вам добрым советом и поделится опытом.

Другие разделы


Щенкам шпица 2 недели

Сегодня щенкам шпица исполнилось ровно 2 недели. Что же нового произошло за эту неделю? Начну с главного события. В конце этой недели наши щенки открыли глаза!

На какой день щенки открывают глаза

Обычно щенки открывают глаза на 12-17 день. На 14 день после рождения наши щенки шпица открыли глаза. Первыми это сделали мальчики. Пока щенки шпица видят слабо, по положение улучшится примерно к концу следующей недели.

Щенки шпица встают на лапки

Молодые шпицы еще ползают, но уже пытаются вставать на лапки. А это означает, что скоро грядёт их переселение из коробки в вольер. Они все больше времени проводят в одиночестве, потому что Оливия стала чаще отлучаться по делам. Но мама не бросает своих младенцев, а контролирует их на коротком расстоянии. Как только Оливия услышит знакомый писк, так мчится к своему ребенку.

Кормим щенков реже

Интервал между приемами пищи увеличился до 4 часов. Кормим реже. Оливия уже сама привыкла к такому графику. Кстати, сейчас она стала подпускать нас к щенкам. И мы этому рады! А еще у Оливии началась линька. На днях Маша вычесала очень много шерсти.

Дали клички щенкам немецкого шпица

На днях из кинологического клуба нам сообщили, что клички щенков должны начинаться на букву «М». И мы поспешили подобрать имена, которые на наш взгляд соответствуют характерам наших щенков.

  • Девочку назвали Молливией (Молли). Неделю назад красавица с трудом переворачивалась, если оказывалась на спине. Сейчас ее мышцы окрепли и позволяют контролировать движения. Неделю назад Молли весила 194 грамма, сегодня 347. Прибавила за неделю 153 грамма.
  • Смуглого крепыша назвали Мэйлом. Этот шпиц хорошо развивается. Полюбуйтесь на него! Прошлый весовой контроль показал 195 граммов, а сейчас 352. Его достижение 157 граммов.
  • Серьезного, брутального и немногословного щенка теперь зовут Марселем. Он хорошо питается, крепко спит и не доставляет проблем. Неделю назад весил 221 грамм, а сегодня 342. Прирост составил 121 грамм.
  • А этого рыжика теперь мы зовем Маркизом. Он самый мелкий из помета. Маркиз весил 182 грамма, а сейчас 295. Немного не дотянул до третьей сотни. Его прогресс по итогам недели 113 граммов. На сегодня это самый низкий результат. Щенок при этом хорошо питается, не плачет от голода, и его среднесуточный прирост в весе составляет в среднем 16 граммов.

Щенок шпица кричит

Немецкий шпиц Молли заставила нас поволноваться. В течение двух дней она кричала, не могла уснуть, ползая по периметру коробки. Ее явно что-то беспокоило! Мы обратились к ветеринару. Щенки шпица впервые отправились в путешествие. В этот день они побывали в ветеринарном кабинете, который находится в Рудничном районе города Кемерово.

Точную причину недуга ветеринару определить не удалось. Возможно, капризы Молли связаны с появлением зрения. По внешним признакам у щенка все нормально, животик не твердый, волчьей пасти нет! Предположили, что малышке не хватает молока и она голодная. По совету врача купили «Сучье молоко» и стали им подкармливать нашу малышку. Молли успокоилась после кормления и уснула на руках. Еще ей будем давать «Эспумизан» 3 раза в день по 1 капле.

Владелец частной ветеринарной клиники Наталья осмотрела всех щенков и сказала, что все здоровы! У всех щенков едва заметные роднички размеров с маленькую бусинку. Думаю, через неделю родничков уже не будет.

P.S.

  • Возможная причина крика у щенка – это запор. В этом возрасте они не могу сами сходить в туалет. Вылизывая, мама стимулирует щенка для справления естественной нужды. А вдруг мама забыла? Тогда возьмите ватный тампон, смочите его теплой кипяченой водой. Кончиком влажного тампона сделайте несколько круговых движений по животу щенка. При успехе край тампона пожелтеет. То же самое проделайте в анальной области.
  • Когти у щенков отрастают очень быстро и требуют еженедельного ухода. В противном случае, живот мамы будет в царапинах.

_ _

С каждым днем наши щенки крепнут, взрослеют и меняются. Меняемся и мы, приобретая опыт! Переживаем, радуемся, не досыпаем. Но это приятные хлопоты! Мы заботимся о щенках шпица и хотим видеть их здоровыми и жизнерадостными!

? ПОДРОБНОСТИ В ЭТОМ ВИДЕО

О других новостях из жизни наших щенков читайте в следующей статье.

Щенки померанского шпица описание

Щенки померанского шпица отличаются от щенков других декоративных пород. Чтобы не ошибиться и выбрать здорового чистокровного песика, нужно изучить все внешние характеристики и психологию животного. Давайте вместе изучим особенности щенков породы померанца и узнаем все о том, как выбрать здорового щенка.

В статье читайте также о покупке щенка и стоимости, прочитав наши рекомендации, вы точно определитесь — в каком возрасте должен быть ваш щенок на момент покупки, какого пола он должен быть и окраса.

Здоровый щенок

Щенки померанского типа шпицев отличаются от классических узкомордых. У померанца короткая мордочка, маленькие ушки, густой подшерсток, толстые щеки, высоко посаженный хвост, толстые лапы. У классического шпица все наоборот, а шерсть заметно другая – без густого подшерстка. Поэтому она торчит во все стороны. У померанского же шерсть торчит дыбом верх, голова у него скругленная, а в целом щенок напоминает игрушечного мишку. В одном помете могут рождаться как представители померанского типа, так и классические.

Так как мы говорим о померанце, то и рассматривать здоровье будем померанских шпицев. Осмотрите питомник, в котором находитесь и пришли за покупкой померанца. Если там грязно и не соблюдаются элементарные санитарные нормы, померанскому шпицу там находиться небезопасно. Густая шерсть померанца требует заботы. Поэтому любое загрязнение может негативно сказаться на ней. В таком случае паразиты на коже разводятся гораздо быстрее и не исключено заражение гельминтами.

Также важно, чтобы у собаки были документы – ветеринарный паспорт и карточка. Следует проверить, есть ли клеймо у собаки и сколько прививок сделано, обычно это уже две и прививка от бешенства. А еще вы увидите в документах дату проведения дегельминтизации. Здоровый щенок имеет задорный характер, он ласков и виляет хвостом при знакомстве. Он активен и жизнерадостен, а вот внешние признаки тоже помогут узнать, болеет ли щенок.


Так как глазки померанца окружает пушистая шерсть, то они часто слезятся. Но это нормально, после покупки щенка вам нужно ухаживать за глазами и вовремя промывать их. Но если в глазках наблюдается закисание и гнойные выделения – это нехорошо, и может говорить о простуде или аллергии.

Маленькие ушки вполне нормально очищаются, если за ними ухаживают, а вот кожа, на покрытых шерстью участках довольно чувствительная – проверьте её на наличие покраснений и прыщиков.

Глаза у всех шпицев миндалевидной формы слегка раскосые, а прикус ножницеобразный. Обратите внимание на белоснежный оттенок зубов и запах изо рта. Вокруг ануса не должно быть загрязнений, коготки аккуратные и подушечки лап чистые. Кожа здорового щенка не имеет перхоти и раздражений.

Ещё немного о стандартах

Чтобы судить о здоровье померанца, нужно обратить внимание на его пропорции. Как вы уже поняли, классический шпиц имеет узкую мордочку, но и у померанца она в меру узкая и напоминает немного лисью. А вот черепная коробка, наоборот, широковата, форма головы плавно сужается к кончику носа. Если вы заметили резкое сужение  — скорее всего перед вами или смешенный тип или классический шпиц, а пропорция 2:4 характеризует померанского шпица.

Идеально, если высота собаки будет равна длине в холке. То есть пропорция тела 1:1- квадрат для померанца самый идеальный вариант. Но хвост прикрывающий половину спины создает впечатление об округлом силуэте собаки. Такой себе компактный воздушный шарик, соблазняющий хозяина скорее приласкать его и потрепать густую шерсть.

Ушки у выбранного вами щенка должны быть заостренные, маленькие и близко посаженные друг к другу. Они практически не обрастают шерстью, а вот грудка напротив — вся покрыта длинной шерстью, создавая вокруг шеи объемный воротник. Также шерстка гуще на лопатках и основаниях передних и задних лап. Хвост у померанца напоминает опахало и закручен на спину наверх полукольцом.


У карликового шпица просматривается так называемая улыбка и кажется, что собака всегда воодушевлена. Обратите внимание на передние лапки – они всегда прямые, а задние отставлены назад. У шпица должно быть крепкое телосложение и толстые лапки.

В зависимости от возраста и пола

Выбрать щенка можно в любом возрасте, но лучше, чтобы он уже был выкормлен маминым молоком хотя бы месяца 1,5. Тогда щенок померанского шпица укрепляет походку и набирает силы. На момент покупки он, как правило, уже имеет хороший иммунитет, противостоящий всяким инфекциям и вирусам.

Приобретая щенка, которому на момент покупки 2 месяца, вы можете рассчитывать, что его обучите чему угодно. Ведь начиная с маленького возраста, щенки уже отлично поддаются дрессировке. К тому же щенку будет легче привыкнуть к вам в таком возрасте.

Если вы планируете выставочную карьеру для собаки, лучше выбрать померанского шпица в возрасте от 4 до 5 месяцев от рождения. Тогда вы можете судить о здоровье по зубам. В этом возрасте у шпица должны быть в наличии стандартный набор. Если какого-то зуба не будет или вырастет кривой, двойной и так далее – вы сможете отказаться от покупки.

Но также в этом возрасте собаки линяют и вид у них не привлекательный. Зато вы сможет просмотреть все линии корпуса под шерстью и определить – идеален ли ваш питомец. Не стоит пугаться линьки, совсем скоро у собаки вырастет еще более густая и красивая шерсть, которая, кстати, бывает разнообразных оттенков. К году у шпица будет привлекательный «наряд» и замечательный густой подшерсток.

Вы может выбрать любого пола щенка. Но самое главное, чтобы потом собака не мучилась. Если вы не собираетесь вязать собаку, лучше выбрать мальчика. Но у мальчиков более вздорный характер, а внешний вид, наоборот, более впечатляющий.

Хотя и здесь бывают исключения и нужно хорошо присмотреться, вы можете подобрать себе достаточно спокойного кобеля или игривую суку. Для выбора потребуется немало времени, но это того стоит. Кстати шпицы – это выбор многих знаменитостей, например Сильвестра Сталлоне, стоимость собак тоже немаленькая и варьируется в зависимости от класса и популярности питомника.

Деление на классы

Все щенки померанца можно разделить на классы в зависимости от их выставочных характеристик. Померанский шпиц, щенки которого такие очаровашки, делится на такие  классы :

  • Шоу-класс;
  • Брид-класс;
  • Пэтт-класс.

Если вы понятия не имеете об этих классах, хотите щенка для души, в качестве домашнего любимца семьи, то вам подойдет пэт-класс щенков. Стоимость их намного дешевле, но это не значит. Что щенок больной. Он такой же красивый и здоровый, просто по стандарту имеет некоторые дефекты, возможно, которые вы и не увидите, пока вам не укажут на них.

Это позволяет снизить цену на таких щенков, ведь их не допустят к племенному  разведению и на выставки им путь закрыт. Но ведь это не помешает вам насладиться общением с животным, правда?

Шоу-щенки и выглядят экстравагантно и не имеют дефектов прикуса, посадки хвоста, равномерно окрашенные. Они допускаются к выставкам и разведению. А вот брид – только разводят, к выставкам же они не пригодны. В общем перед вами открывается возможность выбора в трех ценовых категориях – от 500 и до 2000$, а ваше дело выбрать подходящий ценовой диапазон для вашего кармана.

Информация о породе — Клиника здоровья животных

Ваш финский шпиц

Забота о верном спутнике

финских шпица: какая уникальная порода!

Ваша собака особенная! Она ваш лучший друг, компаньон и источник безусловной любви. Скорее всего, вы выбрали ее, потому что вам нравятся Finkies, и вы ожидали, что у нее будут определенные черты, которые будут соответствовать вашему образу жизни:

  • Защитник семьи: хороший сторожевой пес
  • Бдительный, любопытный и занятой
  • Игривый и энергичный
  • Хорошо с детьми
  • Любящая и верная своим хозяевам
  • Живая, с доброжелательным характером

Однако идеальной собаки не бывает! Возможно, вы также заметили эти характеристики:

  • Может быть буйным и хулиганским, особенно в более молодом возрасте
  • Чувствительный по натуре, медленно созревает
  • Лает или жевает, когда скучно
  • Может быть независимым и волевым
  • Любит копать
  • С подозрением относятся к незнакомцам

Это все того стоит? Конечно! Она очень индивидуальна, и вы любите ее за это! Она игривый компаньон, которому нравятся дети.Ей нужно много упражнений, но она чувствительна, верна и защищает свою семью.

Финский шпиц возник в Финляндии и представляет собой древнюю охотничью породу, известную своей лисьей внешностью. Это национальные собаки Финляндии, которых ласково называют «лающие птичьи собаки». Они опытные охотники, которые обрабатывают свою добычу деревом, а затем используют свою кору, чтобы предупредить охотников. Финский шпиц — очень умная собака, в которой сильная воля и независимость сочетаются с семейной преданностью. Это в целом здоровая порода со средней продолжительностью жизни 12-15 лет.

Здоровье вашего финского шпица

Мы знаем, что, поскольку вы очень заботитесь о своей собаке, вы хотите заботиться о ней. Вот почему мы кратко изложили проблемы со здоровьем, которые мы будем обсуждать с вами в течение жизни вашего финского шпица. Зная о проблемах со здоровьем, характерных для финских шпицев, мы можем разработать план профилактики, чтобы отслеживать и, надеюсь, предотвратить некоторые предсказуемые риски.

Многие болезни и состояния здоровья являются генетическими, то есть связаны с породой вашего питомца.Среди генетических исследователей и практикующих ветеринарных врачей существует общее мнение о том, что описанные здесь состояния имеют значительную частоту встречаемости и / или влияние на эту породу. Среди генетических исследователей и практикующих ветеринарных врачей существует общее мнение о том, что описанные здесь состояния имеют значительную частоту встречаемости и / или влияние на эту породу. Это не означает, что у вашей собаки будут эти проблемы; это просто означает, что она больше подвержена риску, чем другие собаки.Мы опишем наиболее распространенные проблемы, с которыми сталкиваются финские шпицы, чтобы дать вам представление о том, что может произойти в ее будущем. Конечно, мы не можем здесь описать все возможные варианты, поэтому всегда обращайтесь к нам, если вы заметили какие-либо необычные признаки или симптомы.

Это руководство содержит общую информацию о здоровье, важную для всех собак, а также наиболее важные генетические предрасположенности финских шпицев. Эта информация поможет вам и нам вместе спланировать уникальные медицинские потребности вашего питомца. В конце буклета мы также включили описание того, что вы можете делать дома, чтобы ваша Финки выглядела и чувствовала себя лучше.Вы будете знать, на что обращать внимание, и мы все почувствуем себя лучше, зная, что мы максимально заботимся о вашем приятеле.

Ежедневная чистка зубов вашей собаки предотвратит заболевания пародонта.

Общая информация о здоровье вашего финского шпица

Стоматологические заболевания

Заболевания зубов — наиболее частая хроническая проблема домашних животных, поражающая 80% всех собак к двум годам. И, к сожалению, у вашего финского шпица чаще, чем у других собак, есть проблемы с зубами.Он начинается с образования зубного камня на зубах и прогрессирует до инфицирования десен и корней зубов. Если мы не предотвратим или не вылечим стоматологическое заболевание, ваш друг потеряет зубы и окажется в опасности повредить почки, печень, сердце и суставы. Фактически, продолжительность жизни вашего финского шпица может сократиться на один-три года! Мы будем регулярно чистить зубы вашей собаки и сообщать вам, что вы можете сделать дома, чтобы сохранить эти жемчужно-белые зубы чистыми.

Инфекции

Финские шпицы восприимчивы к бактериальным и вирусным инфекциям — тем же самым, что и все собаки, — таким как парвовирус, бешенство и чумка.Многие из этих инфекций можно предотвратить с помощью вакцинации, которую мы будем рекомендовать в зависимости от болезней, которые мы наблюдаем в нашем районе, ее возраста и других факторов.

Ожирение

Ожирение может быть серьезной проблемой для здоровья финских шпицев. Это серьезное заболевание, которое может вызвать или усугубить проблемы с суставами, нарушения обмена веществ и пищеварения, боли в спине и болезни сердца. Хотя соблазнительно накормить друга, когда она смотрит на вас своими задушевными глазами, вы можете «полюбить ее до смерти» с помощью остатков еды для людей и собачьих угощений.Вместо этого обнимите ее, почистите ей шерсть или зубы, поиграйте с ней в игру или, возможно, возьмите ее на прогулку. Ей станет лучше, и тебе тоже!

Яйцо аскариды под микроскопом.

Паразиты

Все виды червей и насекомых могут вторгаться в тело вашего Финки, как внутри, так и снаружи. Все, от блох и клещей до ушных клещей, может заразить ее кожу и уши. Анкилостомы, круглые черви, сердечные черви и власоглавы могут попасть в ее организм разными способами: пить нечистую воду, ходить по зараженной почве или быть укушенными инфицированным комаром.Некоторые из этих паразитов могут передаваться вам или члену семьи и представляют серьезную проблему для всех. Для вашего собачьего друга эти паразиты могут причинить боль, дискомфорт и даже смерть, поэтому важно, чтобы мы регулярно проверяли их. Мы также порекомендуем профилактические лекарства, если это необходимо, чтобы сохранить ее здоровье.

Стерильный или нейтральный

Лучшее, что вы можете сделать для своего финского шпица, — это стерилизовать его (кастрировать самцов). У женщин это означает, что мы хирургическим путем удаляем яичники и, как правило, матку, а у мужчин — хирургическим путем удаляем яички.Стерилизация или стерилизация снижает вероятность некоторых видов рака и исключает вероятность того, что ваш питомец забеременеет или у него появятся нежелательные щенки. Выполнение этой операции также дает нам возможность, пока ваш питомец находится под наркозом, выявить и устранить некоторые заболевания, которые могут развиться у вашей собаки. Например, если вашему питомцу нужен рентген бедра или удаление щенячьего зуба, это будет хорошее время. Это удобно для вас и легко для вашего друга. Регулярный анализ крови перед операцией также помогает нам определить и принять меры предосторожности в отношении общих проблем, которые увеличивают анестезиологический или хирургический риск.Не волнуйтесь; мы обсудим конкретные проблемы, которые мы будем искать, когда придет время.

Генетическая предрасположенность финских шпиц

Диабет

Сахарный диабет — довольно распространенное заболевание у собак. Заболеть может любая порода, но заболеваемость финки выше среднего. Собаки с диабетом не могут регулировать метаболизм сахаров и нуждаются в ежедневных инъекциях инсулина. Это серьезное заболевание, которое важно диагностировать и лечить как можно раньше.Симптомы включают увеличение количества еды, питья и мочеиспускания, а также потерю веса. Если у него появятся признаки, мы проведем лабораторные анализы, чтобы определить, есть ли у него это заболевание, и обсудим с вами варианты лечения. Лечение требует серьезных затрат времени и ресурсов. У хорошо контролируемых собак с диабетом сегодня такая же продолжительность жизни, как и у других собак.

Кровотечение

Существует несколько типов наследственных нарушений свертываемости крови у собак. Они варьируются по степени тяжести от очень легкой до очень тяжелой.Часто домашнее животное кажется нормальным, пока не произойдет серьезная травма или пока не будет проведена операция, а затем может возникнуть сильное кровотечение. Финские шпицы особенно подвержены некоторым относительно редким заболеваниям крови.

Гемолитическая анемия и тромбоцитопения возникает, когда иммунная система выходит из строя и начинает атаковать собственные эритроциты или тромбоциты животного. Если иммунная система разрушает эритроциты, ваша собака быстро становится анемичной, слабой и вялой. Его десны будут беловатыми или желтыми вместо обычного ярко-розового цвета.Если иммунная система разрушает тромбоциты, его кровь не свертывается должным образом, и у него будут синяки или ненормальное кровотечение. Мы проведем диагностические тесты на свертываемость крови, чтобы выявить эти проблемы, прежде чем проводить какие-либо операции. Чтобы замедлить или остановить разрушение клеток иммунной системой, мы пропишем стероиды и другие иммунодепрессанты. Иногда требуется экстренное переливание эритроцитов или тромбоцитов.

Болезнь фон Виллебранда — нарушение свертывания крови, часто встречающееся у финских шпиц.Мы проведем диагностический анализ времени свертывания крови или специальный анализ ДНК крови на болезнь фон Виллебранда или другие подобные заболевания, чтобы выявить эту проблему, прежде чем проводить операцию.

Проблемы с глазами

Мало что так сильно влияет на качество жизни вашей собаки, как правильное функционирование ее глаз. К сожалению, финские шпицы могут унаследовать или развить ряд различных заболеваний глаз, некоторые из которых могут вызвать слепоту, если не лечить сразу, а большинство из них могут быть чрезвычайно болезненными! Мы будем оценивать его глаза при каждом осмотре, чтобы искать какие-либо признаки беспокойства.

Катаракта

Катаракта — частая причина слепоты у старых финских шпицев. Мы будем следить за тем, чтобы линзы его глаз стали более непрозрачными, то есть они выглядели мутными, а не прозрачными, когда мы его осматриваем. Многие собаки хорошо приспосабливаются к потере зрения и прекрасно ладят. Также возможна операция по удалению катаракты и восстановлению зрения.

Глаукома, заболевание глаз, поражающее финских шпицев, а также людей, является чрезвычайно болезненным заболеванием, которое при отсутствии лечения быстро приводит к слепоте.Симптомы включают косоглазие, слезотечение, посинение роговицы (прозрачной передней части глаза) и покраснение белков глаз. Владельцы домашних животных редко замечают боль, хотя она бывает часто и может быть очень сильной. Люди, у которых есть определенные типы глаукомы, часто сообщают, что они чувствуют себя так, как будто их ударили ножом в глаз! Ой! В запущенных случаях глаз может выглядеть увеличенным или опухшим, как будто он выпуклый. Мы проведем его ежегодный скрининг на глаукому, чтобы диагностировать и начать лечение как можно раньше.Глаукома требует неотложной медицинской помощи. Если вы заметили симптомы, не медлите и позвоните нам, обратитесь в скорую помощь!

Прогрессирующая атрофия сетчатки (PRA) — это наследственное заболевание, при котором глаза генетически запрограммированы на слепоту. К сожалению, финские шпицы немного чаще, чем другие собаки, болеют этим заболеванием. PRA не является болезненным, но и неизлечимым. У собак с плохим геном ранние симптомы, такие как куриная слепота или расширенные зрачки, обычно появляются в возрасте от трех до пяти лет.Для этого состояния доступен генетический тест.

Нормальный рентген бедра

Рентгеновский снимок собаки с дисплазией тазобедренного сустава.

Дисплазия бедра и локтя

И бедра, и локти подвержены риску дисплазии, наследственного заболевания, которое вызывает неправильное развитие суставов и приводит к артриту. Скованность в локтях или бедрах вашего финского шпица может стать для него проблемой, особенно по мере взросления. Вы можете заметить, что он начинает хромать в ногах или ему трудно вставать из положения лежа.Мы можем вылечить артрит — чем раньше, тем лучше — чтобы минимизировать дискомфорт и боль. Мы сделаем рентгеновские снимки костей вашей собаки, чтобы выявить проблемы как можно раньше. В тяжелых случаях, ограничивающих жизнь, иногда может помочь хирургическое вмешательство. Имейте в виду, что у собак с избыточным весом артрит может развиться на несколько лет раньше, чем у собак с нормальным весом, что вызывает чрезмерную боль и страдания!

Проблемы с коленом

Иногда коленная чашечка вашего финского шпица может выскользнуть из своего места (это называется вывихом надколенника).Вы можете заметить, что он бежит и внезапно берет заднюю ногу и подпрыгивает на несколько шагов. Затем он толкает ногу в сторону, чтобы вернуть на место коленную чашечку, и он снова в порядке. Если проблема легкая и затрагивает только одну ногу, вашему другу может не потребоваться дополнительное лечение, помимо лекарств от артрита. Когда симптомы серьезны, может потребоваться хирургическое вмешательство, чтобы выровнять коленную чашечку, чтобы она не выскочила из места.

Волчанка

Системная красная волчанка — довольно редкое аутоиммунное заболевание, вызванное борьбой иммунной системы собаки с самим собой.Это приводит к хроническому воспалению кожи, суставов и внутренних органов, которое в тяжелых случаях иногда приводит к смерти. Чаще поражаются финские шпицы, симптомы появляются в среднем возрасте, примерно от трех до семи лет. Лекарства нет, но лекарства могут помочь справиться с симптомами. Солнечный свет может вызвать обострение, поэтому избегайте воздействия солнечного света или используйте безопасный солнцезащитный крем для собак на чувствительных частях тела, таких как уши и носы.

Эпилепсия

Есть три типа судорог у собак: реактивные, вторичные и первичные.Реактивные судороги вызваны реакцией мозга на метаболические проблемы, такие как низкий уровень сахара в крови, органная недостаточность или токсин. Вторичные судороги являются результатом опухоли головного мозга, инсульта или травмы. Если не удается найти другую причину, заболевание называется первичной или идиопатической эпилепсией. Эта проблема часто является наследственным заболеванием, которым обычно болеют финские шпицы. Если ваш друг склонен к припадкам, они обычно начинаются в возрасте от шести месяцев до трех лет. Первоначальное диагностическое обследование может помочь найти причину.Чтобы контролировать приступы, обычно необходимо пожизненное лечение, при этом необходимо проводить периодические анализы крови для отслеживания побочных эффектов и эффективности. Если у вашей собаки припадок: осторожно не позволяйте ей пораниться, но не пытайтесь контролировать ее рот или язык. Ему это не поможет, и он может случайно вас укусить! Отметьте продолжительность припадка и позвоните нам или в больницу скорой помощи.

Проблемы с анальными железами

Финских шпицев предрасположены к этому длительному болезненному состоянию, при котором в одной или нескольких областях вокруг ануса появляются язвы.Признаки включают перенапряжение или явную боль при дефекации, кровотечение, запор, вылизывание пораженного участка или выделения вокруг прямой кишки с неприятным запахом. Состояние может быть трудно поддающимся лечению и требует пожизненного приема лекарств, питания по рецепту, а иногда даже хирургического вмешательства.

Pemphigus foliaceus. Обратите внимание на корки и выпадение волос на верхней части носа.

Аутоиммунное заболевание кожи

Pemphigus foliaceus — поверхностное кожное заболевание, которое чаще встречается у финских шпицев. Это часто начинается в возрасте около четырех лет и вызывает корки и выпадение волос, обычно на верхней части носа и внутри ушной раковины.У некоторых собак он может попасть на подушечки ног и ногти на ногах. Бактерии обычно проникают в поврежденную область, поэтому вторичные кожные инфекции являются обычным явлением. Кожные корки обычно появляются и ослабевают; лекарства нет, но есть множество эффективных методов лечения. Солнечный свет усугубляет ситуацию, поэтому перед выходом на улицу нанесите солнцезащитный крем без цинка на чувствительные части тела.

Болезнь сердца

Некоторые финские шпицы наследуют сердечное заболевание, известное как стеноз легочной артерии. Это заболевание вызывает частичное затруднение кровотока от сердца к легким, что означает, что сердце должно работать больше, чтобы перекачивать достаточно крови.Если состояние достаточно серьезное, ваша собака может упасть в обморок или просто потерять энергию во время упражнений. У него также может быть затрудненное дыхание, кашель или он может не расти так сильно, как следовало бы. Мы проверим это заболевание при жизни вашей собаки и обсудим с вами варианты лечения, если у нее есть такое заболевание. При тяжелых симптомах возможно хирургическое вмешательство.

Расщелина губы или неба

Ваш финский шпиц с большей вероятностью, чем другие породы, родится с расщелиной губы или неба, то есть отверстием в губе или нёбе.Легкие случаи могут не требовать лечения, но более серьезные дефекты требуют хирургического вмешательства для предотвращения осложнений. Мы проверим эту аномалию во время его первого осмотра щенка.

Гипофизарный нанизм

У некоторых финских шпицев может быть необычное заболевание гипофиза, вызывающее ограниченную выработку гормона роста. Заболевание, называемое гипофизарной карликовостью, тормозит развитие и может вызвать чрезмерно пушистую шерсть щенка. Иногда возникают другие кожные изменения, включая облысение, чрезмерную пигментацию, тонкую или чешуйчатую кожу.В основном эти маленькие парни просто меньше своих сверстников. Если ваш приятель пострадал, могут потребоваться дополнительные инъекции.

Расстройство глотания

Крикофарингеальная дисфункция или крикофарингеальная ахалазия (CPA) — это заболевание перстно-глоточной мышцы в горле, которое не расслабляется должным образом, что приводит к неспособности глотать. Это в первую очередь рассматривается как наследственный дефект у щенков финского шпица, но может передаваться и у взрослых собак с низким уровнем гормонов щитовидной железы, нервными проблемами, иммунными проблемами или определенными типами инфекций.Если у вашего щенка есть эта проблема, вы заметите, что он давится или срыгивает после неоднократных попыток глотать. Важно вовремя поймать болезнь, потому что пневмония является частым осложнением, если ее не лечить. Хорошая новость заключается в том, что хирургическая коррекция часто приводит к восстановлению способности нормально глотать.

Глухота

Наследственная глухота была отмечена у некоторых родословных Финки, поэтому, если у него здоровые уши, а он по-прежнему игнорирует вас, может потребоваться более тщательная проверка слуха, включая анализ мозговых волн, если это показано.Если вы подозреваете, что он может плохо слышать, как следует, сразу же назначьте встречу с нами, поскольку проблема также может быть вызвана тяжелой инфекцией уха.

Облысение X

Известно, что облысение X или дисбаланс половых гормонов надпочечников вызывает неоднородное выпадение волос. Это также может привести к появлению пушистой или шерстяной шерсти с каждой стороны тела вашего друга. Стерилизация часто решает проблему. Это заболевание иногда можно лечить с помощью тех же лекарств, которые используются при болезни Кушинга, другом заболевании, затрагивающем надпочечники.Алопеция X — скорее косметическая проблема, чем серьезная медицинская проблема, но ответственные финские заводчики шпицев рекомендуют не использовать пораженных особей для разведения.

Щитовидные железы располагаются по обеим сторонам шеи рядом с дыхательным горлом.

Проблемы с щитовидной железой

финских шпицев предрасположены к распространенному заболеванию, называемому гипотиреозом, при котором организм не вырабатывает достаточное количество гормонов щитовидной железы. Признаки могут включать сухость кожи и шерсти, выпадение волос, предрасположенность к другим кожным заболеваниям, увеличение веса, боязнь, агрессию или другие изменения в поведении.Ежегодно мы будем проводить скрининг крови на наличие заболевания. Лечение обычно простое: заместительная гормональная терапия назначается в виде таблеток.

Уход за своим финским шпицем дома

Многое из того, что вы можете сделать, чтобы ваша собака была счастливой и здоровой, является здравым смыслом, как и люди. Следите за ее диетой, следите за тем, чтобы она много занималась спортом, регулярно чистите зубы и шерсть, и звоните нам или в больницу скорой помощи для домашних животных, когда что-то кажется необычным (см. «На что обращать внимание» ниже).Обязательно придерживайтесь графика обследований и прививок, который мы ей рекомендуем. Именно тогда мы проведем ей необходимые «обследования» и тест на заболевания и состояния, которые распространены у финских шпицев. Еще один очень важный шаг в уходе за вашим питомцем — это оформление медицинской страховки для домашних животных. Безусловно, медицинские обследования и процедуры будут необходимы ей на протяжении всей жизни, а медицинская страховка для домашних животных поможет вам покрыть эти расходы.

Обычный уход, диета и упражнения

Включите ее повседневный уход в свой график, чтобы помочь вашей Финки жить дольше, оставаться здоровее и счастливее в течение всей ее жизни.Невозможно переоценить важность правильного питания и режима упражнений.

  • Наблюдайте за своим питомцем, как за малышом. Держите двери закрытыми, подбирайте за собой и перекрывайте комнаты по мере необходимости. Это убережет ее от неприятностей и от предметов, которые нельзя класть в рот.
  • Расчесывайте ее шерсть по мере необходимости, хотя бы раз в неделю.
  • Финские шпицы обычно имеют хорошие зубы, и вы можете поддерживать их в идеальном состоянии, чистя их не реже двух раз в неделю!
  • Чистить ей уши еженедельно, даже когда она была щенком.Не волнуйтесь, мы покажем вам, как это сделать!
  • Это умная собака с большим количеством энергии, поэтому поддерживайте ее ум и тело активными, иначе ей будет скучно. Вот тогда и начинаются шалости.
  • У нее высокий инстинкт добычи, поэтому ее нужно выгуливать на поводке и обязательно установить прочный забор.
  • Соблюдайте единообразие диеты вашей собаки и не давайте ей еды.
  • Соблюдайте качественную диету, соответствующую ее возрасту.
  • Регулярно тренируйте собаку, но сначала не переусердствуйте.

Что смотреть для

Любой необычный симптом может быть признаком серьезного заболевания или просто незначительной или временной проблемой.Важно знать, когда обращаться за ветеринарной помощью и как срочно. Многие болезни вызывают у собак характерное сочетание симптомов, которые в совокупности могут быть явным сигналом того, что вашему финскому шпицу нужна помощь.

Звонки в офис

Позвоните нам, чтобы записаться на прием, если вы заметили какой-либо из этих знаков:

  • Изменение аппетита или потребления воды
  • Зубной камень, неприятный запах изо рта, красные десны или сломанные зубы
  • Кожный зуд (расчесывание, жевание или облизывание), выпадение волос
  • Летаргия, психическая вялость или чрезмерный сон
  • Страх, агрессия или другие поведенческие изменения

Скорая помощь

Немедленно обратитесь за медицинской помощью, если вы заметили какой-либо из этих признаков:

  • Расчесывание или тряска головой, болезненность ушей или выделения из ушей
  • Неспособность или напряжение при мочеиспускании; обесцвеченная моча
  • Помутнение, покраснение, зуд или другие отклонения от нормы в глазах
  • Повышенный голод и жажда, похудание
  • Десна другого цвета, кроме ярко-розового
  • Общее нежелание бегать или играть
  • Любая ненормальная дрожь, дрожь или чрезмерный непроизвольный тремор
  • Напряжение при дефекации, кровотечение, лизание области вокруг прямой кишки или выделения с неприятным запахом
  • Затруднение глотания или рвота
  • Легко вздрагивает, не реагирует на невидимые звуки
  • Тусклая шерсть, облысение, вялость, прибавка в весе

Партнеры в сфере здравоохранения

ДНК-тестирование — это быстро развивающаяся область, в которой постоянно появляются новые тесты, которые помогают в диагностике наследственных заболеваний, прежде чем они могут стать проблемой для вашего друга.Самую свежую информацию о ДНК и других скрининговых тестах, доступных вашему другу, можно найти на сайте www.Genesis4Pets.com.

Ваш финский шпиц рассчитывает, что вы позаботитесь о нем, и мы надеемся на сотрудничество с вами, чтобы обеспечить ему долгую и здоровую жизнь. Наша цель — обеспечить наилучшее возможное медицинское обслуживание: медицинское обслуживание, основанное на ее породе, образе жизни и возрасте. Свяжитесь с нами, если у вас возникнут вопросы или проблемы.

Артикул:

  • Акерман Л.Генетическая связь: руководство по проблемам со здоровьем у чистокровных собак. Второе издание. AAHA Press; 2011.
  • Белл Дж.С., Кавана К.Е., Тилли Л.П., Смит Ф.В. Ветеринарно-медицинский справочник по породам собак и кошек. Джексон, Вайоминг. Тетон Нью Медиа; 2012.
  • Гоф А., Томас А. Породная предрасположенность собак и кошек к болезням. 2-е издание. Вили-Блэквелл; 2010.
  • Crook A, Dawson S, Cote E, MacDonald S, Berry J. База данных по наследственным заболеваниям собак [Интернет]. Университет острова Принца Эдуарда.2011. [цитировано 11 апреля 2013 г.]. Доступно по ссылке: http: /ic.upei.ca/cidd/breed/finnish-spitz
  • Проблемы со здоровьем, связанные с конкретными породами [Интернет]. Американский кинологический клуб Canine Health Foundation, Inc. [цитировано 11 апреля 2013 г.]. Доступно по адресу: http: /www.akcchf.org/canine-health/breed-specific-concerns/? Breed = finnish-spitz

Amazon.com: K9PrintArt Подушка с милыми щенками померанского шпица, 16×16, многоцветная: для дома и кухни


В настоящее время недоступен.
Мы не знаем, когда и появится ли этот товар в наличии.
  • Убедитесь, что это подходит введя номер вашей модели.
  • Милые щенки померанского шпица
  • 100% полиэфирная ткань
  • Двусторонняя печать
  • Заполнен 100% полиэстером и сшит
  • Индивидуальный крой и шитье вручную
  • Только чистка на месте / химчистка

Вариант сайта сплайсинга OCA2 у немецких шпиц с глазокожным альбинизмом

Abstract

Мы исследовали семью немецких шпицев, в которой в результате вязки черного кобеля с белой сукой были получены три щенка с неожиданным светло-коричневым окрасом шерсти, слегка пигментированными губами и носом и голубыми глазами.Комбинированный анализ сцепления и гомозиготности, основанный на полностью пенетрантном моногенном аутосомно-рецессивном типе наследования, выявил критический интервал в 15 МБ на хромосоме 3. Мы получили данные о последовательности полного генома от одной пораженной собаки, трех волков и 188 контрольных собак. Фильтрация частных вариантов выявила единственный вариант с прогнозируемым высоким воздействием в критическом интервале в LOC100855460 (XM_005618224.1: c.377 + 2T> G LT844587.1: c.-45 + 2T> G). Вариант полностью совмещен с фенотипом в семье.Мы генотипировали 181 контрольную собаку с нормальной пигментацией от разных пород, включая 22 неродственных немецких шпицев, которые были гомозиготными дикого типа. Сравнительный анализ последовательностей показал, что LOC100855460 фактически представляет собой 5’-конец собачьего гена OCA2 . Сборка эталонного генома CanFam 3.1 неверна и отделяет первые два экзона от оставшихся экзонов гена OCA2 . Мы амплифицировали собачий фрагмент кДНК OCA2 с помощью ОТ-ПЦР и определили правильную полноразмерную последовательность мРНК (LT844587.1). Варианты в гене OCA2 вызывают окулокожный альбинизм 2 типа (OCA2) у людей, разведение розовых глаз у мышей и аналогичные фенотипы у кукурузных змей, медака и мексиканских пещерных четвероногих рыб. Таким образом, мы пришли к выводу, что наблюдаемый окулокожный альбинизм у немецкого шпица, скорее всего, вызван идентифицированным вариантом в 5’-сайте сплайсинга первого интрона собачьего гена OCA2 .

Образец цитирования: Caduff M, Bauer A, Jagannathan V, Leeb T (2017) OCA2 вариант сайта сплайсинга у немецких шпицев с глазокожным альбинизмом.PLoS ONE 12 (10): e0185944. https://doi.org/10.1371/journal.pone.0185944

Редактор: Клэр Уэйд, факультет ветеринарии Сиднейского университета, АВСТРАЛИЯ

Поступила: 11 июля 2017 г .; Одобрена в печать: 21 сентября 2017 г .; Опубликовано: 3 октября 2017 г.

Авторские права: © 2017 Caduff et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Данные о последовательности всего генома 192 собак доступны в Европейском архиве нуклеотидов (ENA). Полный список инвентарных номеров приведен в таблице S4. Полноразмерная последовательность мРНК OCA2 собаки доступна под номером LT844587 из ENA.

Финансирование: Это исследование было поддержано грантами Швейцарского национального научного фонда (CRSII3_160738; http://www.snf.ch) и Фонда Альберта-Хайма (№ 105; http: // www.albert-heim-stiftung.ch/). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Глазокожный альбинизм (ОКК) обобщает группу наследственных нарушений синтеза меланина, характеризующихся гипопигментацией кожи, волос и глаз [1]. Шесть из семи типов человеческого OCA относятся к вариантам в конкретном гене: OCA1 ( TYR ), OCA2 ( OCA2 ), OCA3 ( TYRP1 ), OCA4 ( SLC45A2 ), OCALC6 (). и OCA7 ( LRMDA ) [1,2].Варианты OCA2 вызывают OCA2 у людей (OMIM # 203200) и разведение розовых глаз у мышей [3]. Сообщалось о 150 человеческих и 100 мышиных вариантах OCA2 [4,5]. Кроме того, амеланизм у кукурузных змей и альбинизм у медака и мексиканских пещерных тетра-рыб также вызваны вариантами в OCA2 [6–8].

Фенотип у пациентов с OCA2 человека варьирует. Количество остаточного кожного пигмента варьируется и обычно увеличивается с возрастом. Цвет радужной оболочки также варьируется.Как и при других типах глазно-кожного альбинизма, может наблюдаться гипопигментация радужной оболочки, приводящая к полупрозрачности радужной оболочки, уменьшению пигментации пигментного эпителия сетчатки, фовеальной гипоплазии, снижению остроты зрения, аномалиям рефракции, а иногда и степени нарушения цветового зрения. Фенотип OCA2 человека является наиболее распространенным типом OCA у африканцев и также был назван коричневым OCA у африканцев [1,2].

Человеческий ген OCA2 занимает 380 т.п.н. на хромосоме 15, а основная изоформа транскрипта содержит 24 экзона [9].Меланосомный трансмембранный белок OCA2, ранее называвшийся Р-белком, является предполагаемым переносчиком анионов с 12 трансмембранными доменами. OCA2 играет роль в биогенезе меланосом, регуляции pH меланосом и синтезе эумеланина [3,5,10,11]. Он необходим для нормального процессинга и транспорта других меланосомных белков, таких как TYR и TYRP1 [1].

Целью настоящего исследования было раскрыть молекулярную генетику фенотипа окулокожного альбинизма в семье немецких шпицев.

Результаты

Фенотипическая характеристика

Нашему вниманию было обращено внимание на семейство немецких шпицев сорта Гигантский шпиц, где в результате вязки черного кобеля и белой суки получился помет с шестью щенками. Три щенка имели ожидаемый черный окрас шерсти, в то время как другие три щенка, два мальчика и одна девочка, были светло-коричневого окраса, что не могло быть объяснено генотипами известных локусов основного окраса шерсти (рис. 1). Отец, мать и здоровые однопометники имели темные носы и карие или янтарные глаза, тогда как у трех коричневых щенков были светлые губы и нос и голубые глаза, которые с возрастом превратились в зеленые.Появились расширенные зрачки красноватого цвета. Окрас шерсти с возрастом несколько потемнел. Владелец сообщил, что больные щенки щурились от яркого солнечного света (светобоязнь) и с трудом воспринимали жесты руками при ярком солнечном свете. В отчетах заводчиков указано, что собаки с подобным фенотипом ранее были замечены в этой линии собак. Эти данные свидетельствуют о моногенном аутосомно-рецессивном типе наследования.

Рис. 1. Фенотипы окраски шерсти в исследованном семействе гигантских шпиц.

(А) Белая мать и черный отец помета. ( B) Фотографии двух больных щенков и одного здорового брата слева в возрасте одной недели. (C, E) Больная собака GS103 с зелеными глазами и светлым носом в возрасте 4 и 5,5 месяцев соответственно. (D, F) Больная собака GS104 в возрасте 4 и 7 месяцев соответственно.

https://doi.org/10.1371/journal.pone.0185944.g001

Картирование причинного локуса

Мы генотипировали всех членов семьи на чипе Illumina canineHD SNP и использовали комбинированный подход сцепления и гомозиготности в семье с шестью потомками.Параметрический анализ сцепления был выполнен в предположении полностью пенетрантного, моногенного аутосомно-рецессивного наследования признака. Этот анализ выявил 10 сегментов размером ≥ 1 Мб, которые показали положительные оценки LOD (таблица S1). Картирование аутозиготности у трех пораженных собак выявило три гомозиготных региона с общими аллелями (таблица S2). Только один сегмент генома, Chr3: 28,747,944–43,731,542, обнаруживает как сцепление, так и гомозиготность (Рис. 2).

Рис. 2. Комбинированное картирование сцепления и гомозиготности.

Мы выполнили параметрический анализ сцепления рецессивного признака у всех восьми членов семьи и картирование гомозиготности трех пораженных немецких шпицев.Десять связанных сегментов генома обозначены оранжевым цветом, а три гомозиготных сегмента с общими аллелями указаны красным. Только одна область на хромосоме 3 показала как сцепление, так и гомозиготность и считалась критическим интервалом (стрелка). В частности, эта область размером ~ 15 Мбайт соответствует Chr3: 28 747 944–43 731 542 (сборка CanFam 3.1).

https://doi.org/10.1371/journal.pone.0185944.g002

Идентификация причинного варианта

Мы повторно секвенировали весь геном одной пораженной собаки и вызвали однонуклеотидные, а также индель-варианты относительно эталонного генома здорового боксера (CanFam 3.1). Генотипы пораженного немецкого шпица были дополнительно сравнены со 188 геномами собак разных пород и тремя геномами волков, которые были секвенированы в ходе других исследований. Мы предположили, что причинный вариант должен полностью отсутствовать во всех других геномах, кроме немецкого шпица с глазокожным альбинизмом.

В пределах критического интервала этот процесс фильтрации дал только один единственный частный вариант с прогнозируемым влиянием на ген, кодирующий белок (Таблица 1).Этот вариант затронул сайт 5’-сплайсинга одиночного интрона LOC100855460 (Chr3: 31,715,704A> C; XM_005618224.1: c.377 + 2T> G).

Мы подтвердили вариант сайта сплайсинга путем секвенирования по Сэнгеру и генотипировали 8 членов семьи, 22 неродственных немецких шпицев (8 гигантских шпицев, 7 миниатюрных шпицев и 7 померанских шпицев) и 159 контрольных собак из различных других пород (рис. 3A). Генотипы этого варианта продемонстрировали идеальную совместную сегрегацию с фенотипом (рис. 3B). Ни одна из 181 контрольной собаки с нормальной пигментацией не имела мутантного аллеля (таблица S3).

Рис. 3. Генотипы помета немецких шпицев.

(A) Хроматограммы секвенирования по Сэнгеру иллюстрируют последовательности гомозиготной собаки дикого типа, гетерозиготного носителя и гомозиготной пораженной собаки. Вариант заменил существенный тимин в положении +2 5’-сайта сплайсинга на гуанин. (B) Родословная помета гигантских шпицев. Генотипы варианта сайта сплайсинга показывают ожидаемую совместную сегрегацию с фенотипом.

https: // doi.org / 10.1371 / journal.pone.0185944.g003

LOC100855460 представляет собой 5’-конец гена OCA2

Поскольку вариант сайта сплайсинга LOC100855460 представлял собой наш лучший кандидат в причинный вариант для наблюдаемого фенотипа окулокожного альбинизма, мы выполнили поиск по BLAST с LOC100855460 для выявления предполагаемых гомологов у других видов млекопитающих. Эти анализы показали, что LOC100855460 соответствует первым двум экзонам человеческого гена OCA2 .В настоящее время неправильная аннотация собачьего гена в этом регионе, скорее всего, связана с ошибкой сборки в эталонном геноме CanFam3.1, который содержит сегмент геномной ДНК размером ~ 300 т.п.н. в перевернутой ориентации (рис. 4).

Рис. 4. Точечная диаграмма Chr15 человека: 27 500 001–29 000 000 против Chr3 собаки: 31 500 001–33 000 000.

Ген человека OCA2 охватывает 380 т.п.н. Точечный график показывает, что эталонная последовательность собаки в ~ 300 т.п.н. инвертирована по сравнению с человеческой последовательностью из-за ошибки сборки в текущем CanFam 3.1 сборка. Из-за этой ошибки сборки первые два экзона собачьего гена OCA2 в настоящее время имеют неправильную ориентацию и аннотированы как LOC100855460 .

https://doi.org/10.1371/journal.pone.0185944.g004

Экспериментальное подтверждение предполагаемой структуры гена собаки

OCA2

Мы подтвердили предполагаемую ошибку сборки генома с помощью длинной ПЦР на геномной ДНК. Затем мы разработали пару праймеров RT-PCR с прямым праймером в LOC100855460 и обратным праймером в собачьем гене OCA2 .ОТ-ПЦР и последующее секвенирование продукта по Сэнгеру продемонстрировали, что LOC100855460 и OCA2 действительно являются частями одного и того же транскрипта.

На основе результатов ОТ-ПЦР и общедоступных данных RNA-seq мы определили полноразмерную последовательность мРНК OCA2 собаки и отправили ее в Европейский нуклеотидный архив (номер доступа LT844587.1). Этот транскрипт содержит открытую рамку считывания из 2532 нуклеотидов, кодирующую белок из 844 аминокислот, который на 83% идентичен 838 аминокислотам меланосомному трансмембранному белку OCA2 человека, изоформе 1 (NP_000266.2). Большинство различий в последовательностях локализовано в первых 180 остатках на N-конце.

На основе нашей пересмотренной собачьей полноразмерной последовательности OCA2 кандидатный вариант, вызывающий кожно-кожный альбинизм у собак, должен быть обозначен как OCA2 : LT844587.1: c.-45 + 2T> G. Он влияет на сайт 5’-сплайсинга первого интрона собачьего гена OCA2 .

Обсуждение

В этом исследовании мы определили вариант сайта сплайсинга в собачьем гене OCA2 как наиболее вероятную причину фенотипа глазокожного альбинизма у собак.Есть два основных аргумента, подтверждающих заявленную причинную связь: Вариант влияет на консервативный динуклеотид GT в 5’-сайте сплайсинга интрона AG-GT [12]. Такое геномное изменение несовместимо с нормальным процессом сплайсинга и, по прогнозам, приведет к потере функции мутантного гена. Во-вторых, мы предоставили доказательства того, что вариант сайта сплайсинга влияет на первый интрон собачьего гена OCA2 . Функциональная роль этого гена в пигментации хорошо известна, и многочисленные генетические варианты у людей, мышей и других позвоночных приводят к фенотипам окулокожного альбинизма, которые очень похожи на фенотипы, наблюдаемые у собак в этом исследовании [3-8]; (OMIA 000202–7994, OMIA 000202–94885). OCA2 мутантных аллелей, как сообщается, в основном блокируют синтез эумеланина с менее выраженным влиянием на синтез феомеланина [4]. У людей с OCA2 наблюдается резкое снижение уровня эумеланина в коже, глазах и волосах, что приводит к кремовому цвету кожи и желто-соломенным волосам, которые с возрастом темнеют [13]. Меланосомы неправильной формы наблюдались у p-дефицитных мышей [14], а измерения содержания меланина показали значительное снижение уровня эумеланина, но не уровня феомеланина [15,16]. OCA2 экспрессия была обнаружена только у черной спинной, но не в желтой брюшной части черно-подпалых ( a t / a t ) мышей, тогда как она присутствовала в вентральной черной коже мышей без агути ( a / a ) [3].Эти данные соответствуют фенотипу собак с дефицитом OCA2 в настоящем исследовании. Основываясь на их генотипах в других локусах окраски шерсти, можно было ожидать, что три пораженных собаки будут черными из-за присутствия доминантного аллеля K B ( E / e ; A w / a ; K B / k y ; B / B , D / — ).Неясно, представляет ли остаточный светло-коричневый пигмент у пораженных собак смесью эумеланина и феомеланина или это аномальный меланин коричневатого цвета.

Накопление пигмента с возрастом было описано у пациентов с OCA2 человека [17] и наблюдалось у пораженных собак, когда цвет глаз изменился с голубого на светло-зеленый, а цвет шерсти потемнел. Наблюдаемая светобоязнь и полупрозрачная радужная оболочка пораженных собак согласуются с описанием нарушений зрения у пациентов с OCA [1,18].Из-за светобоязни таких собак не следует разводить специально, и в будущем следует избегать вязок носителей и носителей.

Это исследование подчеркивает текущее состояние геномных ресурсов собак и многих других видов домашних животных. Хотя было показано, что полногеномное секвенирование представляет собой мощную технологию, когда дело доходит до выявления причинных вариантов менделевских признаков, биоинформатическому анализу данных препятствуют несовершенные сборки эталонного генома и аннотации генов.При имеющихся ресурсах требуется значительный объем интерпретации данных эксперта-человека. В будущем, с появлением более качественных эталонных геномов, можно ожидать, что аналогичный анализ станет проще и будет включать в себя больший объем автоматизированного анализа данных.

В заключение, мы идентифицировали вариант в консервативном 5’-сайте сплайсинга первого интрона собачьего гена OCA2 как наиболее вероятную причину наблюдаемого окулокутанного альбинизма в семье гигантских шпицев.Это облегчит генетическое тестирование, чтобы избежать случайного разведения щенков с этим фенотипом. Наша работа выявила ошибку сборки в сборке CanFam3.1, и мы предоставляем исправленную полноразмерную последовательность собачьей кДНК OCA2 .

Материалы и методы

Заявление об этике

Все эксперименты на животных проводились в соответствии с местными правилами. Собаки в этом исследовании были обследованы с согласия их владельцев. Исследование было одобрено «Кантональным комитетом по экспериментам на животных» (кантон Берн; разрешения 75/16 и 38/17).

Образцы ДНК и генотипирование

Мы получили образцы крови с ЭДТА от обоих родителей и всех 6 щенков помета немецких шпиц (разновидность гигантских шпиц). Мы выделили геномную ДНК с помощью набора Maxwell RSC Whole Blood DNA Kit и Maxwell RSC Instrument (Promega). Генотипирование двух родителей и шести однопометников было выполнено GeneSeek / Neogen на чипе Illumina CanineHD BeadChip, содержащем 220 853 маркера. Мы также использовали 181 образец контрольной ДНК собак из Биобанка Vetsuisse, которые были собраны в ходе других проектов.

Анализ сцепления и картирование гомозиготности

Данные генотипа 8 членов семьи использовали для параметрического анализа сцепления. Уровень вызова был> 95% для всех собак. Используя PLINK v 1.07 [19], маркеры, которые были неинформативными, располагались на половых хромосомах или отсутствовали у любой из 8 собак, имели ошибки Менделя или частоту второстепенного аллеля <0,3125, были удалены. Окончательный сокращенный набор данных содержал 34 356 маркеров. Модель аутосомно-рецессивного наследования с полной пенетрантностью, частота аллеля болезни 0.5 и программное обеспечение Merlin [20] были применены для проверки сцепления. Интервалы с положительными значениями LOD и α = 1 были оставлены для дальнейшего анализа.

Для картирования гомозиготности использовали данные генотипа трех пораженных собак. Маркеры, которые отсутствовали в одном из трех случаев, маркеры на половых хромосомах и маркеры с ошибками Менделя в семье были исключены. Используя варианты — гомозиготная и — гомозиготная группа в PLINK, были идентифицированы протяженные области гомозиготности> 1 Mb. Гомозиготные интервалы в трех случаях пересекались со связанными интервалами, чтобы определить минимальные критические интервалы.

Секвенирование всего генома

Библиотека Illumina TruSeq без ПЦР с размером вставки 350 п.н. была получена от одной пораженной собаки (GS104). Библиотеку секвенировали с 32-кратным охватом генома с использованием считываний 2 x 150 п.н. на приборе Illumina HiSeq 3000. Варианты с одним нуклеотидом и небольшие indel по отношению к сборке референсного генома собаки CanFam3.1 были названы, как описано [21]. Варианты, частные для GS104, были идентифицированы путем фильтрации вариантов, которые содержались в геномах 3 волков и 188 контрольных собак, секвенированных для предыдущих проектов (таблица S4).Частным вариантам был присвоен приоритет в соответствии с их прогнозируемым воздействием с использованием SNPeff [22] и аннотации NCBI Release 104.

Секвенирование по Сэнгеру

Мы использовали секвенирование по Сэнгеру, чтобы подтвердить результаты секвенирования Illumina и выполнить целевое генотипирование для варианта сайта сплайсинга в LOC100855460 . AmpliTaqGold360Mastermix (Applied Biosystems) и пару праймеров GTCTGGCCTTTCCGTGAG (прямой праймер) и CGAAGCTTGTGCTCAATGTC (обратный праймер) использовали для амплификации области с помощью ПЦР.Продукты ПЦР секвенировали непосредственно на капиллярном секвенаторе ABI 3730 (Applied Biosystems) после обработки экзонуклеазой I и щелочной фосфатазой креветок. Обратный праймер использовали в качестве праймера для секвенирования. Мы проанализировали данные последовательности с помощью Sequencher 5.1 (GeneCodes).

ПЦР дальнего действия

ПЦР с дальним диапазоном была проведена с использованием пары праймеров GGCAAACTTGGGAGTGGTAA (Chr3: 31,659,781–31,659,762) иCCTCAAATAAACCATGA (Chr3: 32,346,375–32,346,356) и набора SequalPrep ™ (Invitrogen Long PC).Фрагменты ПЦР анализировали с использованием FragmentAnalyzer (Advanced Analytical).

ОТ-ПЦР

Мы выделили общую РНК из биопсии кожи здоровой контрольной собаки с использованием спин-колонок QIAzol и RNeasy в соответствии с рекомендациями производителя (Qiagen). Образцы РНК обрабатывали ДНКазой, не содержащей РНКаз, для удаления примесей геномной ДНК. Обратную транскрипцию проводили с использованием праймера oligo-dT и обратной транскриптазы Superscript ® IV в соответствии с рекомендациями производителя (Invitrogen).ПЦР и секвенирование проводили с 2 мкл синтезированной кДНК и парой праймеров TTCTTTCTGGCTGACCTCGT (прямой праймер, OCA2, экзон 2 , Chr3: 31,681,124–31,681,105) и ATGCACCATGACCCTTTCTC (обратные праймеры, экзоны 4, 32,38, OCA2, , OCA2, –32 366 608 и Chr3: 32 362 337–32 362 330), используя прямой праймер в качестве праймера для секвенирования. Для определения 5’- и 3’-концов последовательности мРНК OCA2 мы использовали общедоступные данные последовательности РНК из кожи носа собак (доступ к проекту ENA PRJEB14109, образец доступа SAMEA4412813, идентификатор лаборатории LA1666).

Благодарности

Авторы выражают благодарность заводчику Барбаре Тушл и нынешним владельцам собак за предоставленные образцы и фотографии, а также за предоставление информации о родословных своих собак. Авторы также хотят поблагодарить Натали Бесуше, Мюриэль Фрагьер и Сабрину Шенк за квалифицированную техническую помощь. Мы признательны сотрудникам Консорциума баз данных биомедицинских вариантов собак (DBVDC), Гасу Агирре, Кэтрин Андре, Данике Баннаш, Дорин Беккер, Корду Дрогемюллеру, Кари Экенстедт, Оливеру Форману, Стиву Фриденбергу, Еве Ферроу, Урстейону, Марджоту Гигеру, Кристофету Хитену. Vidhya Jagannathan, Tosso Leeb, Hannes Lohi, Cathryn Mellersh, Jim Mickelson, Leonardo Murgiano, Anita Oberbauer, Sheila Schmutz, Jeffrey Schoenebeck, Kim Summers, Frank van Steenbeck, Claire Wade за предоставление данных о последовательности генома собак контрольных собак и волков.Платформа секвенирования нового поколения и межфакультетский отдел биоинформатики Бернского университета признаны за выполнение экспериментов по повторному секвенированию всего генома и обеспечение высокопроизводительной вычислительной инфраструктуры.

Список литературы

  1. 1. Грёнсков К., Эк Дж., Брондум-Нильсен К. Глазокожный альбинизм. Orphanet J Rare Dis. 2007; 2: 43. pmid: 17980020
  2. 2. Монтолиу Л., Грёнсков К., Вей А.Х., Мартинес-Гарсия М., Фернандес А., Арвейлер Б. и др.Повышение сложности: новые гены и новые типы альбинизма. Pigment Cell Melanoma Res. 2014; 27: 11–18. pmid: 24066960
  3. 3. Ринчик Е.М., Бультман С.Дж., Хорстхемке Б., Ли С.Т., Странк К.М., Спритц Р.А. и др. Ген локуса разведения розовых глаз мыши и окулокожного альбинизма человека II типа. Природа. 1993; 361: 72–76. pmid: 8421497
  4. 4. Мартинес-Гарсия М., Монтолиу Л. Альбинизм в Европе. Дж Дерматол . 2013; 40: 319–324. pmid: 23668539
  5. 5.Бриллиант М. Мышиные p (розовоглазое разведение) и человеческие P-гены, кожно-кожный альбинизм 2 типа (OCA2) и меланосомный pH. Pigment Cell Res. 2001; 14: 86–93. pmid: 11310796
  6. 6. Саенко С.В., Ламичхани С., Баррио А.М., Рафати Н., Андерссон Л., Милинкович М.С. Амеланизм у кукурузной змеи связан со вставкой LTR-ретротранспозона в ген OCA2 . Sci Rep.2015; 5: 17118. pmid: 26597053
  7. 7. Фукамачи С., Асакава С., Вакамацу Й., Симидзу Н., Митани Х., Шима А.Консервированная функция медака розового разведения в синтезе меланина и его дивергентная регуляция транскрипции в гонадах у позвоночных. Генетика. 2004. 168: 1519–1527. pmid: 15579703
  8. 8. Протас М.Э., Херси С., Кочанек Д., Чжоу Ю., Уилкенс Н., Джеффри В. Р. и др. Генетический анализ пещерных рыб показывает молекулярную конвергенцию в эволюции альбинизма. Nature Genet. 2006; 38: 107–111. pmid: 16341223
  9. 9. Веб-сайт NCBI Gene, описывающий особенности человеческого гена OCA2 (выпуск аннотации 108).https://www.ncbi.nlm.nih.gov/gene/4948.
  10. 10. Rosemblat S, Durham-Pierre D, Gardner JM, Nakatsu Y, Brilliant MH, Orlow SJ. Идентификация белка меланосомной мембраны, кодируемого геном розового разведения (окулокожный альбинизм типа II). Proc Natl Acad Sci USA. 1994; 91: 12071–12075. pmid: 79
  11. 11. Хиробе Т. Как регулируются пролиферация и дифференцировка меланоцитов ?. Pigment Cell Melanoma Res. 2011; 24: 462–478. pmid: 21375698
  12. 12.Бурсет М, Селедцов И.А., Соловьев В.В. SpliceDB: база данных канонических и неканонических сайтов сплайсинга млекопитающих. Nucleic Acids Res. 2001. 29: 255–259. pmid: 11125105
  13. 13. Манга P, Orlow SJ. Ген разведения Pink-Eyed и молекулярный патогенез тирозиназ-положительного альбинизма (OCA2). J Dermatol. 1999; 26: 738–747. pmid: 10635616
  14. 14. Рассел Э.С. Количественное гистологическое исследование пигмента, обнаруженного у мутантов по окраске шерсти домашней мыши.IV. Природа эффектов генной замены в пяти основных аллельных сериях. Генетика . 1949; 34: 146–166.
  15. 15. Озеки Х., Ито С., Вакамацу К., Хиробе Т. Химическая характеристика меланинов волос у различных мутантов цвета шерсти мышей. J Invest Dermatol. 1995; 105: 361–366. pmid: 7665913
  16. 16. Prota G, Lamoreux M, Muller J, Kobayashi T, Napolitano A, Vincensi MR, et al. Сравнительный анализ меланинов и меланосом, продуцируемых мутантами по окраске шерсти. Пигментные клетки Res . 1995; 8: 153–163. pmid: 7567792
  17. 17. Король Р.А., Крил Д., Арвенка Дж., Окорд А.Н., Виткоп С.Дж. Альбинизм в Нигерии с выделением нового рецессивного окулокутанного типа. Clin Genet. 1980; 17: 259–270. pmid: 6768477
  18. 18. Ли С.Т., Николлс Р.Д., Бандей С., Лаксова Р., Мусарелла М., Шприц Р.А. Мутации гена P при глазно-кожном альбинизме, глазном альбинизме и синдроме Прадера-Вилли плюс альбинизм. N Engl J Med. 1994; 330: 529–534. pmid: 8302318
  19. 19.Перселл С., Нил Б., Тодд-Браун К., Томас Л., Феррейра М.А., Бендер Д. и др. PLINK: набор инструментов для анализа ассоциаций всего генома и популяционных связей. Am J Hum Genet. 2007. 81: 559–575. pmid: 17701901
  20. 20. Абекасис Г.Р., Черный С.С., Куксон В.О., Кардон Л.Р. Мерлин — быстрый анализ плотных генетических карт с использованием разреженных деревьев потоков генов. Нат Жене. 2002; 30: 97–101. pmid: 11731797
  21. 21. Бауэр А., Валук Д.П., Галичет А., Тимм К., Джаганнатан В., Саяр Б.С. и др.Вариант de novo в гене ASPRV1 у собаки с ихтиозом. PLoS Genet. 2017; 13: e1006651. pmid: 28249031
  22. 22. Чинголани П., Платтс А., Ван ле Л., Кун М., Нгуен Т., Ван Л. и др. Программа для аннотирования и прогнозирования эффектов однонуклеотидных полиморфизмов, SnpEff: SNP в геноме штамма Drosophila melanogaster w1118; изо-2; iso-3. Fly (Остин). 2012; 6: 80–92.

Эхокардиографическое исследование здоровых собак индийского шпица с нормальными референсными диапазонами для породы

Резюме

Цель:

Настоящее исследование было направлено на определение нормальных контрольных значений эхокардиографических измерений в M-режиме у здоровых собак индийского шпица и оценку влияния пола и массы тела по этим измерениям.

Материалы и методы:

Эхокардиография в М-режиме была проведена у двадцати четырех клинически здоровых индийских шпиц в возрасте 3-5 лет и весом 7-18 кг. Измерения проводились с правой парастернальной длинной оси левого желудочкового тракта оттока сердца. Регистрировались следующие параметры: внутренний размер левого желудочка, толщина межжелудочковой перегородки и толщина задней стенки левого желудочка во время диастолы и систолы, диаметр левого предсердия, диаметр корня аорты, систолические функциональные параметры левого желудочка, а также показатели и параметры митрального клапана.

Результаты:

Эхокардиографические измерения в М-режиме у здоровых собак индийского шпица были стандартизированы. Пол не влиял на эхокардиографические измерения, за исключением амплитуды экскурсии митрального клапана и временного интервала между началом и концом закрытия митрального клапана, которые были значительно (p <0,05) выше у женщин, чем у мужчин. Внутренний размер левого желудочка в конце диастолы, внутренний размер левого желудочка в конце систолы, размер задней стенки левого желудочка в конце систолы, конечный диастолический объем, конечный систолический объем, ударный объем, сердечный выброс, время выброса левого желудочка и Амплитуда экскурсии митрального клапана достоверно коррелировала (p <0.05) с массой тела у индийских шпиц.

Заключение:

Данные, полученные в настоящем исследовании, могут быть использованы в качестве эталонных значений для конкретных пород для диагностики сердечных заболеваний, а также для будущих исследований на собаках индийских шпицев.

Ключевые слова: собак, эхокардиография, индийский шпиц, M-режим

Введение

Эхокардиография — важный диагностический инструмент, который обычно используется для оценки структуры и функции сердца, а также для диагностики сердечных заболеваний.Для определения сердечной деятельности у здорового человека и диагностики патологических состояний у больного животного необходимо знать размеры сердца, функциональные параметры сердца и сердечные индексы.

Референсные диапазоны эхокардиографических измерений в M-режиме для нормальной популяции собак, включая различные породы, опубликованы [1], но их клиническая полезность ограничена из-за большого разнообразия пород, размеров тела, массы тела и телосложения у собак [1] 2,3]. Эхокардиографические значения для конкретных пород публикуются для различных пород собак, таких как бигль [4], бультерьеры [5], немецкие овчарки [6], уиппеты [7], йоркширские терьеры [8], индонезийские дворняги [9], бордер. Колли [10], лабрадор-ретривер [11,12], собака Раджапалаям [13] и местные нигерийские собаки [14].Индийский шпиц — член семьи шпицев, который в Индии пользовался большим интересом в качестве домашнего питомца. Эхокардиографические измерения у индийских шпицев могут отличаться от собак других пород из-за разницы в происхождении и предрасположенности к сердечным заболеваниям [15-17]. За исключением нескольких сообщений [18,19], подробное эхокардиографическое исследование в М-режиме на индийских шпицах в литературе отсутствует.

Настоящее исследование направлено на определение референсных диапазонов нормальных эхокардиографических измерений в М-режиме у здоровых индийских шпиц и их корреляцию с полом и массой тела животных.

Материалы и методы

Этическое разрешение

Не требуется, поскольку исследование проводилось на собаках с клинически нормальным сознанием, которые были представлены для планового клинического обследования. Письменное согласие было получено от владельцев собак до начала процедуры осмотра.

Животные

В это исследование были включены 24 клинически здоровых в сознании индийских шпицев, принадлежащих клиенту (n = 24; 12 самцов и 12 самок), представленных на плановое медицинское обследование в Ветеринарные поликлиники Индийского института ветеринарных исследований.Средний возраст и масса тела собак составляли 4,25 ± 0,54 года (диапазон = 3-5 лет) и 11,88 ± 2,70 кг (диапазон = 7-18 кг), соответственно. Были отобраны собаки с нормальными сердечно-сосудистыми и физикальными результатами обследования, без сердечных заболеваний в анамнезе и с нормальными результатами электрокардиографии (ЭКГ) в шести отведениях, а также М-режима, двумерного и допплерэхокардиографического обследования.

Эхокардиография

Эхокардиографическое исследование проводилось с помощью цифровой ультразвуковой системы цветного допплера (Chison iVis 60 Expert Vet ® ), Chison Medical Imaging Co., Ltd. оснащена цветным картированием потока и спектральным доплеровским режимом с использованием многочастотного преобразователя с фазированной решеткой 3,5-5,5 МГц.

Подготовка и позиционирование пациента

Правая стенка грудной клетки в области между 3 и 7 ребром и прилегающая область 1-5 см латеральнее грудины была подготовлена ​​к эхокардиографическому исследованию. Собак помещали в положение лежа на правом боку на столе с прорезью посередине, что позволяло проводить все обследования снизу пациента.Собаки были в сознании на протяжении всего обследования, никаких лекарств не применялось.

Измерения

Измерения размеров в М-режиме были получены из правой парастернальной длинной оси левого желудочкового тракта оттока сердца. Эхокардиографическая оценка сердца в M-режиме проводилась по одновременному отображению двумерных эхокардиографических изображений в реальном времени. Эхокардиографические измерения в M-режиме выполнялись в соответствии с рекомендациями Американского общества эхокардиографии с использованием передового метода измерения [20].

Изображения левого желудочка получали, помещая курсор в точку сразу после сухожильных хорд перпендикулярно межжелудочковой перегородке и задней стенке левого желудочка [3]. Измерения в M-режиме, записанные для левого желудочка, включали: внутренний размер левого желудочка в конце диастолы (LVIDd), внутренний размер левого желудочка в конце систолы (LVID), размер задней стенки левого желудочка в конце диастолы (LVPWd), левый желудочек размер задней стенки в конце систолы (LVPW), толщина межжелудочковой перегородки в конце диастолы (IVSd) и толщина межжелудочковой перегородки в конце систолы (IVS).

Измерения митрального клапана проводились, когда открытие и закрытие створок митрального клапана было четко видно. Были идентифицированы различные точки на изображении митрального клапана в М-режиме, и были записаны следующие измерения: 1) Амплитуда экскурсии митрального клапана (амплитуда DE), которая представляет собой максимальный ход краниальных створок митрального клапана во время раннего диастолического наполнения левого желудочка, 2) Скорость открытия митрального клапана во время ранней диастолы (наклон DE), 3) Скорость закрытия митрального клапана во время ранней диастолы (наклон EF), 4) Интервал времени между началом закрытия митрального клапана (точка A) до конца закрытия митрального клапана (точка C) я.е. AC-интервал, 5) E-точка до разделения межжелудочковой перегородки (EPSS), которая представляет собой расстояние между межжелудочковой перегородкой и максимальным начальным открытием митрального клапана E-точкой.

Диаметр корня аорты (AOD) измеряли в конце диастолы от вершины передней стенки аорты до вершины задней стенки аорты. Измерения проводились на участке развертки, по крайней мере, с одной видимой створкой клапана. Диаметр левого предсердия (LAD) измеряли в конце систолы от верха задней стенки аорты до верха перикарда.Отношение LAD: AOD определялось как показатель для расчета размера левого предсердия.

Расчеты

Формула Тейхгольца [21] предназначена для расчета следующих показателей:

Конечный диастолический объем (КДО) (мл) = 7 (LVIDd) 3 /2.4+LVIDd

Конечный систолический объем (ESV) ) (мл) = 7 (LVIDs) 3 /2.4+LVIDs

Ударный объем (SV) (мл / удар) = LVEDV-LVESV

Сердечный выброс (CO) (л / мин) = (Частота сердечных сокращений × ход объем) / 1000

Фракционное укорочение (FS) (%) = (LVIDd-LVIDs / LVIDd) × 100

Фракция выброса (EF) (%) = (EDV-ESV / EDV) × 100

Фракция утолщения межжелудочковой перегородки (IVSFT) (%) = (IVSs-IVSd) / IVSd × 100

Фракция утолщения задней стенки LV (LVPWFT) (%) = (LVPWs-LVPWd) / LVPWd × 100

Толщина диастолической межжелудочковой перегородки до диастолической задней стенки левого желудочка Соотношение толщины стенки = IVSd / LVPWd

Диастолическая толщина межжелудочковой перегородки к диастолическому внутреннему размеру левого желудочка = IVSd / LVIDd

Диастолическое левое ve Отношение внутреннего размера желудочка к диастолической толщине задней стенки левого желудочка = LVIDd / LVPWd

Другие показатели рассчитывались с использованием установленной формулы [5].

Скорость укорачивания окружного волокна (Vcf) (см / с) = (LVIDd-LVID) / (LVIDd × LVET), с LVIDd и LVID в см; LVET во второй

Фракция миокарда LV (LVfracd) = (IVSd + LVPWd) / (IVSd + LVPWd + LVIDd).

Статистический анализ

Данные представлены в виде средних значений ± стандартное отклонение (SD). Непарный t-критерий Стьюдента использовался для определения различий между самцами и самками собак. Был проведен линейный регрессионный анализ и рассчитан коэффициент корреляции Пирсона (r) для определения влияния массы тела на эхокардиографические параметры.Корреляция считалась положительной и значимой, когда коэффициент корреляции составлял ≥0,40, а значимость — ≤0,05. Для статистического анализа использовали компьютерное программное обеспечение SPSS версии 17 (SPSS Inc., Чикаго, Иллинойс). Значения p <0,05 и p <0,01 считались значимыми при 5% и 1% соответственно.

Результаты

Среднее ± стандартное отклонение эхокардиографических измерений у индийских шпицев представлено в. Среднее ± стандартное отклонение эхокардиографических измерений у самцов и самок индийских шпицев суммировано в таблицах — и, соответственно.Корреляция веса тела различных эхокардиографических измерений у индийских шпицев суммирована в. Пол не влиял на эхокардиографические измерения, за исключением амплитуды DE и интервала AC, которые были значительно (p <0,05) выше у женщин, чем у мужчин. LVIDd, LVID, LVPW, EDV, ESV, LVET и амплитуда DE продемонстрировали положительную корреляцию с массой тела.

Таблица-1

Эхокардиографические измерения в М-режиме у индийских шпицев.

  • LV9292s (мм)
  • 13,25-14 ± 2,79 ± 6793 36,74 -40,00 903 LVP87 0,39 63,75 ± 8,85
    Параметры (единицы) Среднее ± стандартное отклонение (всего) 95% ДИ Диапазон
    BW (кг) 11.88 ± 2,70 10,43-13,32 7-18
    LVIDd (мм) 35,15 ± 4,77 32,61-37,69 28,80-46,50
    20,59-24,48 18,80-29,30
    IVSd (мм) 7,59 ± 0,93 7,09-8,08 6,0-9,5
    IVSs (мм) 8.2-17.30
    LVPWd (мм) 8.19 ± 1,07 7,62-8,76 6,20-10,00
    LVPWs (мм) 12,21 ± 1,38 11,48-12,95 10,10-14,80
    16.01-19.20 11.90-22.50
    Ao (мм) 17.93 ± 2,80 17.44-20.42 12.50-23.10
    LA: Ao 0,93 ± 0,079 0,74-1,08
    EDV (мл) 53.85 ± 18,29 44,10-63,60 31,67-99,65
    ESV (мл) 17,53 ± 7,07 13,76-21,29 10,89-32,98
    29,39-43,25 16,38-67,33
    CO (л / мин) 4,24 ± 1,55 3,41-4,07 2,02-6,79
    FS (%) 21,13-45,76
    EF (%) 67.15 ± 8,26 62,75-71,55 44,34-77,93
    IVSFT (%) 74,12 ± 20,30 63,30-84,94 18,84-111,68 43,82-55,72 25,58-62,90
    IVSd / LVPWd 0,98 ± 0,22 0,86–1,10 0,77–1,68
    IVSd / LVID3d 902 902–0,24 0,17-0,29
    LVIDd / LVPWd 4.32 ± 0,54 3,30-5,48 4,03-4,61
    LVET (с) 0,24 ± 0,01 0,22-0,27 0,16-0,30
    Vcf (круг / с) 1,23-1,65 0,64-2,08
    ГРП LV 0,31 ± 0,03 0,29-0,33 0,26-0,37
    DE amp. (мм) 12,13 ± 2,65 10,71-13,54 6,0-17,0
    Наклон DE (мм / с) 233.19 ± 93,69 183,27-283,12 103,60-517,60
    Наклон EF (мм / с) 119,84 ± 25,21 106,41-133,28 интервал 78,60-152,4092 78,60-152,4092 50-80 59,03-68,47
    EPSS (мм) 4,62 ± 1,15 4,01-5,24 3,0-7,0

    Режим эхо-карты

    Mographic-2 измерения у самцов индийских шпиц.

    9079 9079 IVSd (мм) -50 ± 1079,63 66,9 9079,93 ± 4,39 4,38 4,38 — -247,94 ± 6,43 53793 58,75 -64,11
    Параметры (единицы) Среднее ± стандартное отклонение (мужчины) 95% ДИ Диапазон
    Масса тела (кг) 10,88 ± 7,69 8,62-13
    LVIDd (мм) 35,26 ± 5,06 31,03-39,50 31-47
    LVID (мм) 22,99 ± 3,95 2 19,68-26,29 19,68-26,29 7.34 ± 1,15 6,37-8,30 6-10
    IVSs (мм) 12,45 ± 3,01 9,93-14,97 8-17
    LVPWd (мм) ,06 7,22-8,91 7-10
    LVPWs (мм) 11,99 ± 1,58 10,66-13,31 10-15
    LA (мм) 16,89 ± 3,53 13,99 16,89 ± 3,53 12-22
    Ao (мм) 17.81 ± 2,92 15,37-20,25 13-21
    LA: Ao 0,95 ± 0,11 0,85-1,04
    EDV (мл) 55,36 ± 2079 72,37 37-100
    ESV (мл) 18,02 ± 7,21 11,99-24,05 11-32
    SV (мл) 37,34 ± 15,32 24,53 -67
    CO (л / мин) 3.76 ± 1,42 2,58-4,94 2-6
    FS (%) 36,59 ± 7,76 30,10-43,08 21-46
    EF (%) 57,67-75,53 44-78
    IVSFT (%) 68,71 ± 22,68 49,74-87,67 19-95
    LVPWFT (%) 26-58
    IVSd / LVPWd 0.91 ± 0,10 0,83-1,00
    IVSd / LVIDd 0,21 ± 0,24 0,18-0,24
    LVIDd / LVPWd
    LVET (с) 0,26 ± 0,03 0,23–0,28
    Vcf (с) 1,36 ± 0,46 0,98–1,75 — fracd 0,30 ± 0,02 0.28-0,33
    Усилитель DE (мм) 10,63 ± 2,67 8,39-12,86 6-15
    Наклон DE (мм / с) 193,40 ± 659,24 193,40 ± 65,86 104-287
    Крутизна EF (мм / с) 116,80 ± 28,87 92,66-140,94 79-152
    50-70
    EPSS (мм) 4.50 ± 1,07 3,61-5,39 3-6

    Таблица-3

    Эхокардиографические измерения в M-режиме у самок индийских шпиц.

    3 1492 ± 1,5 0,03 ± 0,779 -23 ± ± 22793 122,88 104,06-141,71
    Параметры (единицы) Среднее ± стандартное отклонение (женщины) 95% ДИ Диапазон
    Масса тела (кг) 12,88 ± 10,88 907-1892-14
    LVIDd (мм) 35,04 ± 4,79 31,03-39,05 29-42
    LVID (мм) 22.09 ± 3,53 19,14-25,04 19-29
    IVSd (мм) 7,84 ± 0,62 7,31-8,36 7-9
    IVSs (мм)
    12,73-15,37 13-17
    LVPWd (мм) 8,33 ± 1,17 7,34-9,31 6-10
    LVPWs (мм) 12,44–13,4 10-14
    LA (мм) 18.33 ± 2,33 16,38-20,27 15-23
    Ao (мм) 20,05 ± 2,33 18,10-22,00 17-23
    LA: Ao 0,91 0,87-0,96
    IVSFT (%) 79,54 ± 17,37 65,01-94,06 57-112
    LVPWFT (%) 5092-603 407 905 -63
    IVSd / LVPWd 1.05 ± 0,29 0,81-1,29 1-2
    IVSd / LVIDd 0,23 ± 0,04 0,19-0,26
    LVIDd / LVPWd 3,366 3-5
    EDV (мл) 52,33 ± 17,27 37,89-66,78 32-80
    ESV (мл) 17,03 ± 7,37 10,87 33
    SV (мл) 35.30 ± 11,19 25,99-44,66 20-50
    CO (л / мин) 4,72 ± 1,63 3,36-6,08 3-7
    FS (%) 36,95 4,29 33,37-40,54 31-43
    EF (%) 67,70 ± 5,60 63,01-72,38 59-75
    LVET (с) 0,24 -0,29
    Vcf (круг / с) 1.52 ± 0,34 1,24-1,80
    ГРП 0,32 ± 0,04 0,29-0,35
    DE амп. 15,03 12-17
    Наклон DE (мм / с) 268,00 ± 63,26 185,58-360,40 189-518
    Наклон EF (мм / с) 87-145
    Интервал переменного тока (мс) * 68.75 ± 8,34 61,77-75,73 60-80
    EPSS (мм) 4,75 ± 1,28 3,68-5,82 3-7

    Вес тела 5

    эхокардиографические измерения на индийских шпицах.

    9079 мм 9092 +13,06 600x − 0,7765 9087 5 1 DE (мм) 0293 0295 доступно в области эхокардиографического исследования на собаках индийских шпицев, настоящее исследование было разработано для определения референсных диапазонов нормальных эхокардиографических измерений в M-режиме у здоровых собак индийских шпицев обоих полов и изучения возможного влияния пола и массы тела на эхокардиографические измерения.

    Внутренний размер левого желудочка, межжелудочковая перегородка и толщина задней стенки левого желудочка у индийских шпиц соответствовали диапазону значений, который считался нормальным для собак с аналогичным размером тела [1]. LVIDd и LVID у индийского шпица были больше, чем ранее сообщалось, у индийского шпица (29,37 ± 0,64 мм и 19,71 ± 0,88 мм) [18], но схожи с показателями индийских собак (34,60 ± 0,81 мм и 22,00 ± 0,58 мм) [22]. LVIDd и LVID не зависели от пола. Аналогичные результаты были опубликованы Boon [1], Kayar et al .[6], Gugjoo и др. . [11] и Саксена [18]. Однако в Whippets, Bavegems et al . [7] сообщили о значительно более высоких значениях внутреннего диаметра левого желудочка у женщин, что было связано с большим отношением средней массы сердца к массе тела у женщин по сравнению с мужчинами. Масса тела достоверно коррелировала (p <0,05) с диастолическими и систолическими внутренними размерами левого желудочка у индийского шпица, аналогично результатам, полученным в предыдущих исследованиях [1,6,8,11,14,22], в то время как у пемброк-вельш-корги и афганских борзых Сообщалось, что LVIDd незначительно коррелировал с массой тела [2].Изменение внутреннего диаметра левого желудочка во время диастолы и систолы указывает на дилатационную или гипертрофическую кардиомиопатию.

    IVSd у индийского шпица было сходным с ранее сообщенным значением у индийского шпица (7,83 ± 1,44 мм) [18], но немного ниже, чем у индийских собак (9,70 ± 0,28 мм) [22]. ИВС у индийского шпица была аналогична индейским собакам (14,1 ± 0,40 мм) [22], но немного ниже, чем ранее сообщавшееся значение у индийского шпица (12,33 ± 1,49 мм) [18]. Незначительное влияние пола на диастолическую и систолическую толщину МЖП в настоящем исследовании соответствовало выводам других исследователей [6,11,18].Масса тела не коррелировала достоверно с размерами IVS у индийского шпица, как и у собак породы бигль [4] и лабрадор ретривер [12], в то время как у нигерийских беспородных собак масса тела была обнаружена значимо коррелированной с IVSd и IVSs [14].

    LVPWd и LVPW у индийского шпица были немного ниже, чем ранее сообщаемые значения у индийского шпица (9,27 ± 0,19 мм и 14,53 ± 0,46 мм) [18], но схожи с показателями индийских собак (8,9 ± 0,26 мм и 11,8 ± 0,34 мм) [ 22]. Размеры задней стенки левого желудочка у индийского шпица достоверно не коррелировали с полом.Напротив, в других исследованиях более высокие значения LVPWd и LVPWs у гончих [4] и немецких овчарок [6] были зарегистрированы у самцов по сравнению с самками. Масса тела существенно не коррелировала с LVPWd у индийского шпица, как и у миниатюрных пуделей, афганских борзых [2], борзых, уиппетов, итальянских борзых [3] и собак лабрадора-ретривера [12]. Однако было обнаружено, что масса тела достоверно коррелирует (p <0,05) с LVPW, что аналогично выводам Boon [1]. Было обнаружено, что у нигерийских беспородных собак масса тела достоверно коррелировала с LVPWd и LVPW [14], в то время как другие исследователи [2,12] не сообщали о какой-либо значительной корреляции между массой тела и размерами задней стенки левого желудочка.

    LAD был аналогичен ранее сообщенному значению у индийского шпица (18,00 ± 0,70 мм) [18], в то время как AOD был немного больше, чем ранее сообщенное значение у индийского шпица (16,50 ± 1,03 мм) [18]. Однако как LAD, так и AOD у индийского шпица были ниже, чем у индийских собак (23,8 ± 0,50 мм и 21,7 ± 0,46 мм) [22]. Пол не влиял на LAD и AOD у индийских шпицев. Напротив, у индонезийских беспородных собак было обнаружено, что AOD больше у самцов, тогда как отношения LAD и LAD / AOD были больше у самок [9].Масса тела не коррелировала достоверно с LAD и AOD у индийского шпица, как и у немецких овчарок [6]. В то время как у собак лабрадор-ретривер только АОТ достоверно коррелировало с массой тела [12]. Вопреки нашим выводам, многие исследователи задокументировали значительную положительную корреляцию между массой тела и размерами левого предсердия и корня аорты у различных пород собак [1,6,22]. Нормальное соотношение левого предсердия к корню аорты (LAD: AOD) у здоровой собаки находится в пределах 0.8 и 1.2 [1]. Соотношение LAD: AOD у индийского шпица было в этом диапазоне и аналогично ранее сообщенному значению у индийского шпица (0,98 ± 0,01) [18], но ниже, чем у бультерьеров (1,7 ± 0,2 мм) [5], йоркширских терьеров (1,37 ± 0,12 мм). ) [8], бордер-колли (1,16 ± 0,21 мм) [10] и индийские собаки (1,10 ± 0,15) [22]. Увеличение ПМЖВ может привести к большему соотношению левого предсердия к корню аорты, что часто наблюдается у пожилых животных, поскольку диаметр левого предсердия увеличивается, а диаметр корня аорты с возрастом уменьшается.

    Конечный диастолический объем, конечный систолический объем и ударный объем у индийского шпица были больше, чем ранее сообщаемые значения у индийского шпица (33.24 ± 1,04 мл; 12,44 ± 1,38 мл; и 20,79 ± 1,49 мл / удар) [18], но аналогичен индийским собакам (53,79 ± 27,56 мл; 18,19 ± 11,26 мл; и 35,58 ± 18,53 мл / удар) [22]. Статистически незначимая разница в объемах левого желудочка между самцами и самками собак соответствовала результатам других исследователей [11,18]. Масса тела достоверно коррелировала (p <0,01) с объемом левого желудочка, аналогично результатам предыдущих исследований [11,12]. Сердечный выброс у индийского шпица был выше, чем ранее сообщалось (2.133 ± 0,19 л / мин) [18]. Более высокий сердечный выброс и ударный объем у мужчин по сравнению с женщинами соответствовали результатам исследования Whippets, где у мужчин-уиппетов сердечный выброс и ударный объем были значительно выше, чем у женщин-уиппетов [7]. Сердечный выброс является мерой общей сердечной функции, но не является чувствительным индикатором сердечной деятельности, поскольку на него влияют многие компенсаторные механизмы, такие как частота сердечных сокращений и ударный объем, которые действуют для поддержания нормального сердечного выброса.

    FS и EF у индийского шпица были похожи на индийских собак (36.61 ± 6,98% и 66,81 ± 9,15%) [22], но немного больше, чем ранее сообщалось значение у индийского шпица (32,69 ± 2,86% и 62,57 ± 4,07%) [18]. Наши результаты относительно отсутствия корреляции между массой тела и FS и EF согласуются с выводами других исследователей [1,12,18], предполагая, что эти измерения не зависят от массы тела. Однако другие исследователи сообщили о слабой отрицательной корреляции между массой тела и ФС и ФВ [6,11]. Вариации в наблюдении FS и EF могут быть результатом зависимости этих параметров от множества факторов, таких как предварительная нагрузка, постнагрузка и сократимость, которые влияют на них [3,5].

    Степень утолщения межжелудочковой перегородки и задней стенки левого желудочка, соответственно, во время сокращения желудочков указывается с помощью IVSFT и LVPWFT. IVSFT был выше, чем у йоркширских терьеров (47,17%) [8], индийских шпиц (57,02 ± 2,88%) [18] и здоровых индийских собак (49,29 ± 28,07%) [22]. LVPWFT был выше, чем у йоркширских терьеров (47,17%) [8] и индийских собак (34,45 ± 25,44%) [22], но ниже, чем ранее сообщаемое значение у индийских шпицев (56,79 ± 2,99%) [18]. Уменьшение процентного изменения толщины межжелудочковой перегородки и задней стенки левого желудочка во время сердечного цикла указывает на снижение сократительной способности миокарда, что может быть связано с длительной перегрузкой объемом.Фракции утолщения IVS и LVPW не показали значительных различий в зависимости от пола. О подобных результатах сообщалось в предыдущих исследованиях [12,18]. Отсутствие связи между фракцией утолщения LVPW и измерениями размеров тела у борзых, уиппетов и итальянских борзых свидетельствует о том, что на этот функциональный индекс меньше влияет широкий разброс размеров тела собак [3]. Соотношения IVSd / LVIDd и IVSd / LVPWd используются для исключения асимметричной гипертрофии перегородки или оценки степени компенсаторной гипертрофии в результате обструкции выходного тракта левого желудочка.Соотношение LVIDd / LVPWd оценивает степень компенсаторной гипертрофии во время сердечного заболевания [1]. Нормальное соотношение LVIDd / LVPWd вместе с объемной перегрузкой левого желудочка предполагает соответствующую компенсаторную гипертрофию. Увеличение соотношения LVIDd / LVPWd указывает на неадекватную гипертрофию, как при дилатационной кардиомиопатии, в то время как уменьшение соотношения LVIDd / LVPWd указывает на чрезмерную гипертрофию, как при гипертрофической кардиомиопатии.

    Время выброса левого желудочка (ВЖ) у индийского шпица было больше, чем у борзых (0.17 с), уиппетов (0,18 с) и итальянских борзых (0,15 с) [3], а также уиппетов (0,16 с) [7] и йоркширских терьеров (0,18 ± 0,02 с) [8]. Vcf представляет собой изменение окружности полости желудочка во время систолы. Vcf у индийского шпица была ниже, чем у нормальных собак (2,2 ± 0,40 цир / с) [1], уиппетов (1,69 ± 0,39 круг / с) [7] и йоркширских терьеров (2,42 ± 0,56 цир / с) [8]. На время выброса влияет объем крови в левом желудочке. При уменьшении преднагрузки происходит уменьшение ЕТ и наоборот.С увеличением постнагрузки увеличивается ЕТ и уменьшается Vcf. Однако увеличение как ET, так и Vcf наблюдается при уменьшении постнагрузки [1]. Фракция миокарда левого желудочка (LV fracd) также является индикатором гипертрофии. LV fracd у индийского шпица был несколько ниже, чем у индийских собак (0,35 ± 0,06) [22]. Незначительная разница в значениях ET, Vcf и LVfrac наблюдалась между самцами и самками шпицев. Напротив, ЭТ левого желудочка было значительно выше, а Vcf значительно ниже у женщин-уиппетов, чем у мужчин [7].

    Амплитуда ДЭ митрального клапана у индийского шпица была аналогична ранее сообщенной величине у индийского шпица (11,67 ± 0,15 мм) [18]. Выявлено, что амплитуда ДЭ достоверно (p <0,05) выше у женщин, чем у мужчин. Это может быть связано с более высокой средней массой тела у женщин, что приводит к большему диаметру желудочков, чем у мужчин. В противоположность этому, Saxena [18] сообщил о значительно (p <0,05) более высокой амплитуде DE у самцов шпицев, что могло быть связано с большей массой тела самцов шпицев, использованных в их исследовании.Масса тела достоверно коррелировала (p <0,05) с амплитудой DE в соответствии с данными у немецких овчарок [6], лабрадоров [11] и индийских шпиц. [18]. Диастолическая экскурсия краниальной створки митрального клапана связана с кровотоком. При уменьшении систолического оттока, как при дилатационной кардиомиопатии, диастолический приток уменьшается, что приводит к уменьшению экскурсии краниальной створки митрального клапана.

    Наклон Mitral DE у индийского шпица составил 233,19 ± 93,69 мм / с. Масса тела не коррелировала достоверно с наклоном DE у индийских шпицев, в отличие от данных, полученных у немецких овчарок [6].Наклон митрального EF представляет собой скорость наполнения левого желудочка или опорожнения левого предсердия и, следовательно, является важным показателем потока через митральный клапан и функцию митрального клапана. Наклон EF у индийского шпица (119,84 ± 25,21 мм / с) был аналогичен ранее сообщенным значениям у индийского шпица (118,13 ± 2,78 мм / с) [18]. Мы не обнаружили никакой связи между массой тела и наклоном митрального EF. Напротив, Kayar et al . [6], Gugjoo и др. . [11] и Saxena [18] сообщили о значительной корреляции между массой тела и наклоном EF у немецких овчарок, индийских шпиц и лабрадоров-ретриверов соответственно.Незначительное влияние пола на наклон митрального DE и наклона EF у индийского шпица согласуется с данными, полученными на немецких овчарках [6]. Интервал времени между началом закрытия митрального клапана и концом закрытия митрального клапана, то есть AC-интервал у индийского шпица, составлял 63,75 ± 8,85 мс. У мужчин был значительно (p <0,05) более высокий интервал AC по сравнению с женщинами. Увеличение интервала АС свидетельствует о повышенном конечном диастолическом давлении в левом желудочке и плохой функции желудочков. EPSS митрального клапана был ниже, чем ранее сообщалось, у индийского шпица (6.07 ± 0,66 мм) [18], но больше, чем у индийских собак (3,4 ± 0,12) [21]. Незначительное влияние пола на EPSS наблюдалось в настоящем исследовании. Вопреки нашим выводам, Bavegems et al . [7] сообщили о значительно более высоких показателях EPSS у самок, чем у самцов, в то время как Noviana et al . [9] сообщили о значительно более высоких показателях EPSS у самцов индонезийских беспородных собак, чем у самок. Некоторые исследователи задокументировали значительное влияние веса тела на EPSS [3,10,12], в то время как другие предположили незначительное влияние веса тела на значение этого параметра [6,7,22].В настоящем исследовании масса тела не оказала значительного влияния на EPSS.

    Уход | Spitzview Japanese Spitz

    При переходе на Spitzview вам будет предоставлена ​​информация о дрессировке для наилучшего старта с вашим японским шпицем.

    Рекомендуется записать вашего щенка в школу для щенков до того, как забрать его, чтобы он мог сразу же продолжить обучение, которое мы уже начали. После завершения они должны пройти вводный тренинг (уровень 1) в Школе послушания.Если вы закончите 12 месяцев школы обидиенс, ваш щенок, и вы, несомненно, проживете вместе в гармонии все остальное время вместе. (Это только 1 ночь в неделю, и это гарантирует, что вы избавитесь от душевной боли от нежелательной девушки.)

    Взяв щенка, вы всегда должны учитывать время, которое у вас есть на дрессировку. Обучение и социализация, которые вы обеспечиваете своему щенку японского шпица в первые 12 месяцев, могут иметь решающее значение для жизни в гармонии с вашим другом японского шпица на всю жизнь.

    Японские шпицы очень активны и могут вести себя немного от 8 недель до 8 месяцев. Выполнив некоторые из приведенных ниже шагов, вы можете сделать это время приятным, а не живым кошмаром.

    СОЦИАЛИЗАЦИЯ «СОЦИАЛИЗАЦИЯ» «СОЦИАЛИЗАЦИЯ» «СОЦИАЛИЗАЦИЯ» (Это так важно !!!)

    Социализация — это термин, который часто используется в учебниках по дрессировке собак, заводчиками и дрессировщиками. Но что это на самом деле означает и как это повлияет на вас, как на нового владельца щенка?

    В социализации есть две части, и обе одинаково важны.Первый — это обучение щенка общению с людьми и другими собаками, а второй (так называемое привыкание — это обучение всего того, что мы хотим, чтобы щенок игнорировал и не беспокоился, например, шум, движение транспорта, предметы домашнего обихода и т. Д.

    )

    Несоциализированные собаки часто бывают пугливыми, агрессивными и негибкими.

    Это печальный факт, что многих собак младше 2 лет бросают в приюты и подвергают эвтаназии из-за проблем с поведением, которых можно было бы избежать с помощью хорошей социализации на раннем этапе.Страх Агрессия — одна из наиболее распространенных проблем поведения.

    Нет ничего хорошего в том, чтобы держать вашего щенка в изоляции с момента, когда он достигнет 4-месячного возраста. Это время абсолютно необходимо для того, чтобы они стали в жизни хорошо разносторонними и приспособленными собаками. Многие люди не социализируют своих щенков и не подвергают их воздействию различного окружения в это время из-за того, что вакцинация еще не завершена, однако крайне важно, чтобы вы делали это безопасно. Если вы пропустите это окно социализации, ваш японский шпиц может вырасти крайне отчужденным и замкнутым для посторонних.Не подвергая их воздействию различных сред и звуков, вы получите очень тревожную собаку, которая постоянно лает на любой шум или на человека. Некоторые даже до крайности набросились от страха.

    Итак, как мы можем работать над социализацией, не подвергая риску их здоровье в это решающее время.

    Начните дома, просто научив их использовать различные шумы и текстуры.

    Восстановление страха — важная черта, которую нужно развивать, чтобы они могли справляться со всеми видами изменений и шумами в большом мире.

    1. Бросьте кастрюлю / кастрюлю / книгу / лопните воздушный шар / хлопните дверью и т. Д., Чтобы издать поразительный звук, когда они этого не ожидают, несколько раз в день и продолжайте, как будто ничего не произошло. Если они увидят, что вы спокойны, они начнут понимать, что не стоит бояться шума.

    2. Подвергайте их воздействию обычных повседневных звуков, таких как звук пылесоса, дверной звонок, газонокосилка, автомобили, проезжающие впереди, и люди, проходящие мимо.Вы также можете использовать YouTube, чтобы воспроизводить звуки, такие как «Отбойный молоток», «Пожарные работы», «Выпечка других собак» и т. Д.

    3. Выставьте на них разные текстуры. Попросите их пройтись по плитке, половицам, траве, по шелестящемуся пластику, неровным поверхностям (отлично подойдет качающаяся доска или водная пила для ловкости)

    4. Дайте им возможность плавать на доской для болота или взорвать циновку в бассейне.

    5. Предложите им пройтись под стульями и мебелью, исследовать домики-кубики и пройти через кошачий туннель.Сверните коврик и пусть щенок перелезет по нему. Не помогай им. Может быть, поместите что-нибудь важное с другой стороны, чтобы побудить их перейти к вам. Важно, чтобы они набрались смелости, чтобы делать все самостоятельно.

    Безопасный выход

    1. Возьмите щенка в клетке в машину. Вы можете припарковаться в оживленных парках и торговых центрах и вынуть их из ящика, чтобы сесть с вами в машину и смотреть в окно.Возьмите с собой угощения, чтобы вознаградить их, когда они спокойно наблюдают за их окружением. Не награждайте их лаем на движение или шум.

    2. Оставив щенка в ящике, вы можете отвезти его в парк, к друзьям, за чашечкой кофе и т. Д., Чтобы он мог безопасно наблюдать за своим окружением. Еще раз побалуйте себя спокойным наблюдением за своим окружением.

    3. Отнесите их к месту возле оживленного входа, например, в Вулворс, школу, парк, спортивные игры и т. Д., И сядьте рядом с ними, чтобы посмотреть.Возьмите с собой пакет печеночных угощений, который можно передать вашему щенку. Кормящие их незнакомцы помогут им почувствовать радость от незнакомцев и не бояться их.

    4. Отнесите их в Баннингс и положите в ящик на тележке. Убедитесь, что вы всегда держите их за руку, поскольку они будут пытаться выпрыгнуть в молодом возрасте.

    5. Вывозите их в прицепе для домашних животных или в коляске для прогулок.

    6. Отведите их в безопасную школу для щенков, где они смогут научиться общаться с другими собаками в безопасной среде.Я рекомендую провести 2 школы для щенков в первые 4-6 недель, чтобы вы могли проводить 2 ночи в неделю, чтобы они сразу же начали хорошо общаться с другими собаками. Чем раньше будет считаться нормальным играть с другими собаками, тем меньше у вас будет шансов, что они будут напуганы и агрессивны по отношению к другим собакам.

    НИКОГДА НЕ ЗАНИМАЙТЕСЬ 2 ЩЕНКАМИ ОДНОВРЕМЕННО !! ОНИ БУДУТ ОБЪЯВЛЯТЬСЯ ВМЕСТЕ, ПРОПУСТИТЬ ВАШУ ВЛАСТЬ И ПРОСТО УПРАВЛЯТЬ СОБСТВЕННЫМ ШОУ.Лучше всего потренироваться от одного до восьми месяцев, а затем приступить к следующему, если вы хотите, чтобы двое друзей выросли вместе. ПОЖАЛУЙСТА, НИКОГДА НЕ ОДИН ВРЕМЯ. ВЫ УСТАНАВЛИВАЕТЕ СЕБЯ НА НЕУДАЧУ !!

    РЕСУРСНАЯ ЗАЩИТА

    В природе большинства щенков будет желание охранять что-нибудь важное для них рычанием или щелканьем, если вы попытаетесь вытащить из них этот предмет. Если этим не управлять и не контролировать с самого начала (следует начать с заводчика через 4-5 недель и продолжить с вами по прибытии), вы можете столкнуться с неприемлемыми проявлениями поведения.

    Никому не нужно домашнее животное, которое будет охранять обувь, игрушки, кости и т. Д. И набросится на любого ребенка / взрослого, который просто проходит мимо, или на бедного ребенка, который идет забирать свою украденную игрушку.

    Мы используем простой прием для борьбы с этим.

    1. Подарите щенку что-нибудь важное, например, симпатичную сочную косточку.

    2. А теперь возьмите что-нибудь еще вкусное, например, теплую курицу с приятным запахом.

    3. Сядьте рядом со своим щенком и одной рукой медленно удалите кость, быстро поместив курицу ему в рот.(Цель состоит в том, чтобы заставить щенка ассоциироваться, что, когда у него что-то отнимают, у него мгновенно возникает приятное ощущение, а не реакция на борьбу за свой предмет. Этот отпечаток останется с ним на всю жизнь)

    4. Теперь верните кость.

    5. Повторять 3-4 раза 1-2 раза в день в течение нескольких недель.

    НИКОГДА НЕ ДЕЛАЙТЕ ВЫШЕУКАЗАННОЕ С ВЗРОСЛЫМ СОБАКОЙ, ЕСЛИ У ВАС НЕ ИМЕЕТСЯ ОПЫТНЫЙ ТРЕНЕР.ЭТО ТОЛЬКО ДЛЯ ЩЕНКОВ ЯПОНСКОГО ШПИЦА В ВОЗРАСТЕ 4-14 НЕДЕЛЬ. ПОСЛЕ ЭТОГО ВРЕМЕНИ ВЫ ДОЛЖНЫ ПРИНЯТЬ ОПЫТНОГО ТРЕНЕРА.

    ОБРАЩЕНИЕ И НАКЛЮЧЕНИЕ

    Молодые щенки японского шпица, которые чрезмерно раздражены и чрезмерно обращаются с ними, имеют тенденцию становиться раздраженными и иногда немного кусаться.

    Японский шпиц — независимая порода, однако большинство новых владельцев не могут устоять перед чрезмерным обращением со своим новым милым белым пушистым комком.

    Как и в случае с маленькими щенками, им нужна структура и спокойное время для процесса обучения и перезагрузки.Лучше всего поместить вашего щенка в загон в доме с некоторыми стимулирующими игрушками и тихую зону отдыха, где вы можете на короткое время вывести его на общение и дрессировку. Затем щенку нужно вернуться в загон, чтобы он мог уснуть и обработать только что усвоенную информацию. Щенкам сначала нужно много спать.

    Если позволить им свободно бегать по дому в этом юном возрасте, это не только повлияет на их приучение к туалету, но и, так сказать, «взорвет их маленькие умы».У вас будет гипогликемия, когда вы будете кусать стимулированного щенка, который не следует командам.

    Не оставляйте маленьких детей наедине с маленьким щенком, во-первых, они могут легко уронить щенка и определенно будут раздражать или чрезмерно стимулировать ум маленького щенка. Важной частью социализации является то, что щенки проводят время с детьми, но только в контролируемой среде под присмотром взрослых.

    Нормальные молодые щенки хотят кусать во время прорезывания зубов, это отличается от игры с кусачками.Убедитесь, что они оставлены в загоне, чтобы было много чего жевать. например, свиное ухо. Это предотвратит их желание жевать вашу мебель. Когда щенок начинает кусаться, выведите его из положения и верните в загон, чтобы он жевал ухо свиньи или поспал, чтобы успокоиться.

    ОБУЧЕНИЕ ТУАЛЕТУ

    1. Установите для щенка регулярное время кормления и следите за тем, когда он пьет воду.

    2. Каждые 30 минут — 1 час выводите щенка на улицу.Также выносите их на улицу сразу после еды и игры.

    3. Поместите их в специально отведенное место для туалета, укажите на это место и скажите «иди в туалет» (или выбранную вами фразу команды туалета).

    4. Не играйте со своим щенком и не обращайте на него внимания, когда вы находитесь на улице. В данный момент вы хотите, чтобы они узнали, что в этих обстоятельствах происходит только одно.

    5. Сразу после того, как они пописали или какали, похвалите их, сказав «хороший мальчик / девочка» одобрительным тоном.

    • Примерно каждые 30 минут — 1 час, вашему щенку, возможно, придется ходить на прогулку более или менее часто. Следите за сигналами, которые им нужно уйти. Это включает кружение, обнюхивание и уход из поля зрения.

    • Не забывайте регулярно чистить какашку щенка, чтобы содержать в чистоте сад. Вам не нужно оставлять их там, чтобы ваш щенок избавился от них в саду.

    • Если вы поймали своего щенка на месте преступления, строго скажите «Нет», а затем выведите его на улицу в указанное место.Они могут или не закончили ходить в туалет, но это будет подтверждать, что именно здесь они должны заниматься своим делом.

    • Вы можете поставить подушку для щенка, закрепленную в держателе для подушечки рядом с внешней дверью, во время тренировки, однако лучше всего следить за своим щенком и выводить его на улицу, так как в конечном итоге вы хотите, чтобы он занимался своими делами. Если разрешить им выходить как на улицу, так и в дом, это может сбить их с толку.

    ОБЩИЕ ПОЛОЖЕНИЯ

    Ниже приводится список основ, которым вы должны научить своего щенка.Следите за «Как делать видео», которые скоро появятся в разделе для участников.

    Рекомендуется записать вашего щенка в школу для щенков до того, как забрать его, чтобы он мог сразу же продолжить обучение, которое мы уже начали. После завершения они должны пройти вводный тренинг (уровень 1) в Школе послушания. Если вы закончите 12 месяцев школы обидиенс, ваш щенок, и вы, несомненно, проживете вместе в гармонии все остальное время вместе.(Это только 1 ночь в неделю, и вы избавите себя от душевной боли от нежелательного поведения.)

    Здоровье, уровень активности, темперамент и личность

    Японский шпиц — порода собак, выведенная в Японии в 1920-х годах. Это шпиц (собака маленького и среднего размера), выведенный для общения, а также в качестве домашнего питомца. Стандарты идеального размера варьируются во всем мире, но японский шпиц, как правило, больше, чем померанский шпиц (его меньший родственник). Белый померанский шпиц, американская эскимосская собака и самоедская собака — собаки, внешне похожие на японского шпица.

    Автор фото @lifeonwhite из Freepik

    Обратите внимание, что у японских шпицев грива вокруг шеи и груди становится более густой и длинной. Эта грива придает японским шпицам благородный и уникальный вид, а также делает их пушистыми и очаровательными.

    Характеристики

    Параметры (единицы) Регрессия (y =) Коэффициент детерминации (r 2 ) Корреляция (r) p-значение для корреляции
    1.143x + 21,58 0,420 0,648 0,003 **
    LVID (мм) 0,707x + 14,13 0,275 0,524 0,018 мм 0,086x + 6,562 0,062 0,2505 0,1747
    IVS (мм) 0,3362x + 9,257 0,1359 0,3686 LVP 0,0800 01448x + 6,475 0,1341 0,3662 0,0815
    LVPWs (мм) 0,227x + 9,516 0,198 0,445 0,041 92 мм 0,1195 0,3457 0,0948
    AOD (мм) 0,3113x + 15,23 0,090 0,3006 0,1289
    0,1289
    0,462 0,680 0,002 **
    ESV (мл) 1,433x + 0,5152 0,301 0,548 0,014 9079 ) 3,167x − 1,287 0,433 0,659 0,0028 **
    CO (л / мин) 0,2468x + 1,310 0,184 0,429
    ПС (%) 0.5567x + 30,16 0,061 0,2485 0,1767
    EF (%) 0,7396x + 58,37 0,058 0,2421 0,1831
    0,439x + 6,904 0.2006 0,447 0,041 *
    Наклон DE (мм / с) 8,146x + 136,5 0,055 0,2353 0,235 Наклон EF (мм / с) 2.544x + 89,69 0,074 0,2729 0,1532
    EPSS (мм) −0,1526x + 6,437 0,1294 −0,3598 0,0855 907 907 0,1685 0,1655 0,4068 0,0589 *
    Vcf (окружность / с) −0,020x + 1,680 0,018 0,1376
    Вес 10-25 фунтов
    Высота 12-15 дюймов
    Окрас и узоры Белый — единственный приемлемый окрас для этой собаки, согласно стандарту породы (по всем все Клубы собаководства)
    Продолжительность жизни 12-14 лет
    Подходит для Семьи с детьми младшего и старшего возраста, пожилые люди и одиночки, квартиры, дома с двором / без двора

    История японского шпица

    Считается, что порода японских шпиц произошла от белых немецких шпицев, импортированных в Японию из Сибири и Китая около 1920 года.Поскольку записи были уничтожены во время Второй мировой войны, полная история породы неясна. Однако известно, что японский шпиц впервые был выставлен в 1921 году на выставке в Токио, а два белых шпица были привезены из Канады в 1925 году. В период с середины 1920-х до середины 1930-х годов белые шпицы, в том числе Кеесхонд (белый Кляйн Wolfsspitz), были импортированы из Канады, США, Австралии и Китая. Японский клуб собаководства установил стандарт породы японских шпиц в 1948 году на основе потомков скрещивания.Пройдя по всему миру, включая Индию, Австралию и, конечно же, Соединенные Штаты, японский шпиц был признан Клубом собаководства Великобритании в 1977 году.

    С 1980-х годов японский шпиц был популярен в Соединенных Штатах и ​​признан рядом клубов, включая Международную кинологическую федерацию.

    Примечание: Американский клуб собаководов (AKC) не признает японских шпицев, но Служба фондовых запасов Американского клуба собаководства признает их породой.

    Интересные факты

    • Порода собак японский шпиц произошла от белых немецких шпицев, импортированных в Японию из Сибири и Китая около 1920 года.
    • Кеесхонд (белый Кляйн Вольфшпиц) сыграл значительную роль в развитии японского шпица.
    • Американский кинологический клуб (AKC) не признает японских шпицев. Вместо этого он признан Фондовой службой Американского клуба собаководства.
    • Белый — единственный окрас, доступный для японских шпицев.
    • У японских шпицев есть грива.
    • Подходит для самых разных семей, в том числе пожилых людей и новичков.
    • Шпицы бывают более чем 50 различных пород.
    • У японских шпицев при рождении уши закручены.
    • Японские шпицы не любят холод так сильно, как шпицы других пород.
    • Японские шпицы — отличные квартирные собаки.
    • Из-за пушистого белого вида японского шпица называют «Облачный пес».
    • Аджилити, флайбол и фрисби — вот чем занимается японский шпиц.
    • Это собака, которая хорошо себя чувствует в общительной среде.
    • Японский шпиц любит привлекать к себе внимание.
    • Японский шпиц не разборчив в еде.
    • Размер этой собаки варьируется в зависимости от стандартов породы и страны.
    • Японский шпиц — маленькая белая собака с пушистым хвостом и густой белой шерстью.

    Темперамент и личность

    Японский шпиц — живая, игривая, а также бдительная собака, которая с течением времени доказала свою способность адаптироваться к широкому спектру стилей жизни.Им нравится быть частью семьи и участвовать во всех аспектах повседневной жизни. Они устанавливают тесные связи со своими семьями, хотя могут быть сдержанными по отношению к незнакомцам. Им нравится быть частью семьи и участвовать во всем, что происходит в семье. Эти породы образуют очень прочные связи со своими семьями, хотя могут быть немного сдержанными, когда находятся рядом с незнакомцами.

    Японский шпиц, с другой стороны, редко проявляет агрессию по отношению к незнакомцам, предпочитая сохранять дистанцию.Эти маленькие клыки сверхчувствительны к своему окружению из-за своей настороженности и сообщат об этом своим владельцам, как только появится незнакомец.

    Японский шпиц имеет красивую белоснежную пушистую двойную шерсть, которая надежно защищает его от непогоды. Если смотреть сверху, их головы среднего размера, но не грубые и не клиновидные. Череп у них самый широкий в затылке и слегка закругленный. У них четко очерченные упоры и не выступающий лоб.Их морда пропорциональна их голове, сужаясь к маленькому круглому черному носу. Губы черные, плотные и твердые.

    Глаза темные, среднего размера, овальной формы, расположены несколько наклонно и не слишком широко расставлены, с черными краями. Уши треугольные, маленькие, стоячие. Уши также расположены высоко, обращены вперед и не слишком широко расставлены. У японского шпица мощная челюсть с правильным, идеальным и полным ножницеобразным прикусом, что подразумевает, что верхние зубы плотно перекрывают нижние.У них сильная изогнутая шея, а также умеренно наклонные плечи с прямыми и сильными передними конечностями.

    Грудь широкая и глубокая. Ребра хорошо изогнутые, живот крепкий и умеренно подтянутый. Их спины прямые и короткие. Поясница широкая и крепкая, с небольшим подъемом к крупу собаки. Их хвосты средней длины, с перьями и высоко посажены, изогнутые на спине японские шпицы.

    Японский шпиц может похвастаться мускулистыми, пропорциональными и сбалансированными задними конечностями.Задние лапы сильные и очень кошачьи, с хорошо мягкими ступнями и темными ногтями.

    5 9092 922 4 из 5 192 192 922 3 из 5 9226 1 Слюни
    Приспособляемость 3 из 5
    Адаптируется к жизни в квартире 4 из 5
    Уровень энергии 4 из 5
    Адаптируется к одиночеству 1
    Переносит холодную погоду 2 из 5
    Переносит жаркую погоду 3 из 5
    Всестороннее дружелюбие 3 из 5
    Для детей 3 из 5
    Для собак 3 из 5
    Для кошек 2 из 5
    Здоровье и уход 4 из 5
    Удаление 2 из 5
    2 из 5
    Легко ухаживать 3 из 5

    Действия

    Японский шпиц — подвижная маленькая собака, которая требует правильного количества ежедневных упражнений, а также умственной стимуляции — в идеале от 20 до 30 минут в день и как можно больше времени без поводка в безопасной среде.Прелесть этих собак в том, что в случае загрязнения шерсти эти очаровательные породы собак моются, как кошки.

    Хорошая идея — дать собаке более короткую прогулку утром и более продолжительную и интересную прогулку днем. Флайбол, послушание и ловкость — вот те виды собачьего спорта, которыми увлекается японский шпиц.

    Японский шпиц также любит свободно бегать в саду за домом, чтобы выпустить пар, но убедитесь, что он находится под присмотром в огороженном дворе, чтобы он не пытался сбежать.

    Примечание: Щенкам японского шпица не следует чрезмерно тренировать, потому что их суставы и кости все еще развиваются, и чрезмерное давление на них может вызвать проблемы у собаки в более позднем возрасте.

    Обучение

    Японский шпиц — умная собака, которая любит только угождать людям. С другой стороны, их обучение должно быть последовательным и всегда справедливым. Эта маленькая собака-компаньон, находящаяся в умелых руках, любит узнавать новое и очень быстро подбирает вещи.

    Японские шпицы по своей природе очень чувствительны, и в результате они плохо реагируют на деспотические тренировки или жесткие методы коррекции, которые не дадут никаких хороших результатов. Они хорошо реагируют на добрые, нежные, позитивные тренировки с подкреплением и наслаждаются общением один на один со своими владельцами во время периода обучения, что является одной из причин, по которым эти собаки преуспевают во многих собачьих видах спорта.

    Когда щенки японского шпица впервые приезжают в свой новый дом, их слишком легко побаловать, потому что они милые и милые.Следовательно, правила и границы должны быть установлены так, чтобы щенок знал, чего от них ждут. Это также помогает установить иерархию и определить, кто является «альфа-собакой» в домашнем хозяйстве, что следует сделать как можно скорее.

    Проблемы со здоровьем

    Японский шпиц — порода собак как активная, так и привлекательная. Тем не менее, вот некоторые из проблем со здоровьем, которым подвержена эта порода:

    • Вывих надколенника. [1]
    • Аллергии.Узнайте больше о сезонной аллергии.
    • Глаза текут.

    Уход и уход

    Японского шпица, как и любой другой породы, необходимо регулярно ухаживать, чтобы поддерживать его шерсть и кожу в хорошем состоянии. Им также необходимо ежедневно выполнять физические упражнения, чтобы оставаться в форме и оставаться здоровыми. Кроме того, собак необходимо кормить высококачественной пищей, которая покрывает все их потребности в питании на протяжении всей жизни.

    Американский клуб собаководства
    Прививки

    Заводчики сделали бы щенкам японского шпица их первые прививки, но им потребуются дополнительные прививки, которыми займутся их новые владельцы.График вакцинации щенка следующий:

    • Возраст от 10 до 12 недель, при том понимании, что щенок не будет полностью защищен сразу, но будет полностью защищен через две недели после второй вакцинации.

    Желательно поговорить с ветеринаром по поводу бустеров, потому что существует много споров о том, нужны ли они собаке после определенного периода. Если собаке когда-либо приходилось заходить в питомник, ее вакцинация должна быть полностью обновлена.

    СВЯЗАННЫЙ: Вакцины для щенков: какие прививки нужны щенку? Ветеринарная консультация

    Стерилизация и стерилизация

    Многие ветеринары рекомендуют подождать, пока собаки немного подрастут, прежде чем стерилизовать или стерилизовать их, подразумевая, что они более зрелые. Поэтому они рекомендуют стерилизовать самцов и самок в возрасте от 6 до 9 месяцев, а иногда даже в возрасте 12 месяцев.

    Другие ветеринары рекомендуют стерилизовать и стерилизовать собак в возрасте 6 месяцев, но никогда раньше, если это не требуется по медицинским показаниям.С учетом сказанного, многие породы уникальны, поэтому всегда полезно проконсультироваться с ветеринаром, а затем следовать его рекомендациям о том, когда следует кастрировать или стерилизовать собаку.

    СВЯЗАННЫЙ: Стерилизованные собаки живут дольше? (Объяснил ветеринар)

    Кормление

    Если вы купите щенка японского шпица у заводчика, он предоставит вам график кормления, и очень важно следовать ему, предоставляя щенку один и тот же корм каждый день, чтобы предотвратить расстройство желудка. Вы можете скорректировать рацион щенка, но делайте это постепенно, чтобы у него не возникло проблем с пищеварением.Если они это сделают, лучше вернуться к своей первоначальной диете и проконсультироваться с ветеринаром, прежде чем пытаться изменить ее снова.

    Несмотря на то, что пожилые собаки не отличаются привередливостью в еде, это не значит, что вам следует предлагать им некачественную еду. Взрослую собаку следует кормить дважды в день, один раз утром и еще раз вечером, высококачественной пищей, которая покрывает все ее потребности в питании.

    Также очень важно, чтобы собаки получали достаточно упражнений, чтобы сжигать лишние калории, иначе они рискуют набрать слишком много веса, что может привести к различным проблемам со здоровьем.Ожирение может сократить продолжительность жизни собаки вдвое, поэтому очень важно с самого начала следить за ее талией.

    Уход

    Шерсть японских шпицев чисто-белая. Несмотря на то, что кажется, что за ними нужно много ухаживать, это не так. Текстура шерсти отталкивает большую часть грязи и мусора. Поскольку шерсть толстая, ее необходимо расчесывать щеткой, чтобы избежать образования узлов и матирования. Не реже двух раз в неделю чистите японского шпица щеткой, доходящей до подшерстка.Это поможет удалить часть мертвых волос и уменьшит объем очистки, необходимой после выпадения. Шерсть этих собак, как правило, более сухая по сравнению с другими породами; таким образом, их следует купать по мере необходимости.

    Слишком частое купание может лишить волосы естественного жира и влаги, что вызовет зуд. По сравнению с другими породами, требования к уходу за японскими шпицами довольно умеренные.

    Щенки

    Поскольку щенки японского шпица шумные и полные жизни, очень важно защитить свой дом и двор до того, как они приедут.Ответственный заводчик с самого начала очень хорошо бы социализировал своих щенков, что привело бы к более общительным, уверенным и дружелюбным собакам.

    С сайта Pixabay

    Примечание: учтите тот факт, что любой щенок, разлученный со своей матерью и однопометниками, может чувствовать себя уязвимым. Чем дольше щенок может оставаться с матерью, тем лучше, но не надолго.

    Необходимые вещи для вашего щенка

    Перед тем, как привезти нового щенка домой, у нового хозяина должно быть кое-что на месте.Ниже перечислены необходимые вещи:

    • Качественные ворота для щенков или малышей, которые можно установить на двери.
    • Разнообразные хорошо сделанные игрушки, в том числе высококачественные жевательные игрушки, подходящие для жевания щенками с учетом того, что у щенка прорезываются зубы в возрасте от 3 до 8 месяцев.
    • Кусачки для ногтей.
    • Емкости для корма и воды хорошего качества, желательно керамические, а не металлические или пластиковые.
    • Щетка для сликера или щетка с мягкой щетиной.
    • Перчатка для груминга.
    • Зубная щетка и паста специально для собак.
    • Шампунь, а также кондиционер для щенков (разработан специально для собак).
    • Хорошо сделанный ошейник или упряжь для собак.
    • Качественная собачья подстилка (не слишком большая и не слишком маленькая).
    • Ящик для собак, который можно использовать как в машине, так и дома.
    • Детские одеяла для клетки и кроватки вашего щенка, когда они хотят вздремнуть или поспать ночью.
    Снижение уровня шума

    Все щенки чувствительны к шуму.Когда в дом приходит щенок японского шпица, очень важно снизить уровень шума. Телевизор и музыку не следует включать слишком громко, потому что это может вызвать стресс у молодого щенка и привести к тому, что он станет застенчивым и робким по мере взросления.

    Усыновление и спасение

    Если вы хотите завести японского шпица, вам может быть сложно найти спасение, которое специализируется на этой породе. Тем не менее, усыновление японского шпица — экономичный вариант. Усыновление домашних животных — это часть стоимости покупки породистой собаки у заводчика или зоомагазина.Когда вы берете японского шпица из приюта, вы можете быть уверены, что ваш питомец прошел все необходимые прививки, получил медицинскую помощь, стерилизован или стерилизован, если это необходимо. Таким образом вы сэкономите немного денег. Кроме того, усыновление взрослой собаки японского шпица позволит вам изучить их поведение гораздо легче, чем попытки предсказать личность щенка по мере его взросления.

    Прайс и заводчики

    Покупка щенка японского шпица у уважаемого заводчика может быть дороже, но это самая безопасная идея.Цена на щенка японского шпица может колебаться от 1000 до 2500 долларов и выше. В случае, если вы получите щенка от родителей, выигравших соревнования, цена будет выше. Иногда более высокая цена связана с репутацией заводчика.

    Примечание: Прежде чем покупать щенка японского шпица, внимательно изучите его и убедитесь, что вы покупаете его у известного заводчика японского шпица. За информацией обращайтесь к ветеринару и другим специалистам по домашним животным, а также к другим владельцам японских шпицев, ответственным заводчикам японских шпицев и спасательным организациям.

    Заключение

    Японские шпицы, потому что они такие милые и ориентированные на человека, являются отличным выбором для начинающих владельцев собак. Им нравится только угождать своим семьям и развлекать их. Они отлично подходят для семей с детьми старшего и младшего возраста; однако иногда игра может быть немного шумной.

    FAQ

    Японский шпиц агрессивен?

    Японский шпиц — любящая, а также дружелюбная порода собак, которая от природы не агрессивна.Однако они могут стать агрессивными, если будут воспитываться в суровых условиях. В результате на их характер влияет среда, в которой они выросли.

    Сколько стоит владение японским шпицем?

    Цена на щенка японского шпица может колебаться от 1000 до 2500 долларов и выше.В случае, если вы получите щенка от родителей, выигравших соревнования, цена будет выше. Иногда более высокая цена связана с репутацией заводчика.

    Японский шпиц много линяет?

    Японский шпиц линяет скорее умеренно, чем сильно.Они сбрасывают пальто один или два раза в год, в зависимости от климата, и это длится около недели. Японских шпиц необходимо чистить каждый день в течение всего этого времени. Считается, что в этот сезон линьки у них есть «взорванная шерсть». Осень и весна — наиболее частые периоды сильной линьки. Их все равно нужно будет расчесывать еженедельно до конца года, чтобы избежать узлов и путаницы и сохранить шерсть в хорошем состоянии.

    Японский шпиц любит воду?

    Большинство японских шпицев любят плавать и купаются в них, когда позволяет погода, особенно в жаркую погоду.Однако, если у вас есть собака, которая не любит воду, не стоит заставлять ее заходить, потому что это только напугает ее.

    Дружелюбен ли японский шпиц с детьми?

    Японские шпицы дружелюбны к детям. Они любят и игривы с детьми, что делает их прекрасными товарищами по играм.Из-за их небольшого размера дети могут грубо играть с ними, пощипывая кожу. В результате требуется тщательный присмотр, чтобы предотвратить резкое поведение детей или маленькой собаки.

    Источники статей:

    1. «Расслабление надколенника у собак». VCA Больницы , vcahospitals.com / know-your-pet / luxating-patella-in-dogs.

    Дрессировка финского шпица | Разумная дрессировка собак

    Дрессировка собак — что работает, а что нет
    Некоторые методы дрессировки собак основаны на том, что заставляет хозяина чувствовать себя хорошо, а не на том, что действительно имеет смысл для собаки. Угощения могут быть отличным мотиватором для дрессировки финского шпица, но если ваша собака будет подчиняться только угощению, то он, , отвечает за его послушание, а не вы. [подробнее]

    Верно или неверно? Все, что нужно собаке, — это любовь
    Как собачий консультант по поведению, я слышу одно из наиболее частых утверждений о собаках: все, что нужно собаке, — это любовь.Так это правда или ложь? Мой ответ может вас удивить! [подробнее]

    Дрессировка щенка — это просто: 4 вещи, которые вы ДОЛЖНЫ делать правильно
    Дрессировка щенка финского шпица не должна быть сложной задачей. Есть четыре простых действия, которые вы можете сделать прямо сейчас, чтобы изменить поведение вашего щенка и упростить обучение. [подробнее]

    График дрессировки щенка: чему и когда учить
    Дрессировка щенка начинается в тот момент, когда вы приносите щенка домой. Если вы воспользуетесь неправильным методом обучения, ваш щенок начнет принимать решения о том, как он хочет, чтобы вы вписались в его жизнь , и это рецепт для конфликтов и проблем с поведением.Что бы ни делал ваш щенок, вы должны правильно реагировать, иначе он научится неправильным вещам. Вот мой рекомендуемый график (чему учить, когда учить) для дрессировки вашего щенка финского шпица. [подробнее]

    Учите своего финского шпица уважать вас
    «Дрессировка уважения» — это метод дрессировки собак, который я использую и рекомендую для дрессировки финского шпица. Собака, которая уважает вас, будет делать то, что вы говорите, и прекратит то, что делает, когда вы скажете ей «Нет». Приучать собаку уважать вас означает взаимодействовать с ней особым образом, вызывающим уважение.[подробнее]

    Решение проблем поведения
    Один из наиболее частых вопросов, которые мне задают владельцы собак: «Как я могу остановить свою собаку (конкретное плохое поведение)?» Мой ответ почти всегда один и тот же, независимо от того, что это за плохое поведение …. [читать дальше]

    Эти видеоматериалы по дрессировке собак превратили приятеля в хорошую собаку
    Иногда легче дрессировать вашего щенка (или взрослую собаку), когда вы можете увидеть правильные методы дрессировки в действии. Я рекомендую эти видео о дрессировке собак, основанные на уважении и лидерстве.[подробнее]

    Вам нужна помощь в дрессировке собак …. Но откуда? Частные уроки? Общественные классы? Книги по дрессировке собак? Видео о дрессировке собак?
    Итак, вашему щенку нужно дрессировать … или вашей взрослой собаке нужно дрессировать … и вам нужна помощь. Стоит ли нанять профессионального тренера, чтобы он приходил к вам домой? отправить вашу собаку на дрессировку? записаться на групповой урок послушания? читать книгу? посмотреть несколько видео? Вот мой совет, где получить помощь в дрессировке собак, когда она вам действительно нужна. [подробнее]

    Учите правильные слова правильными способами
    Мой метод обучения финского шпица включает обучение определенным словам особым образом, чтобы ваша собака не только выучила слова, но и выработала уважительное отношение, которое делает ее счастливой, когда она слушается вас.Учите свою собаку словам, и она поймет, что вы говорите. Учите эти слова правильным образом , и он действительно ДЕЛАЕТ то, что вы говорите. [подробнее]

    Взлом вашего финского шпица
    Есть два ключа к взлому дома. Всего два, но вы должны понять их оба правильно. Я имею в виду, что правильно на 100%, а не на 50%. В противном случае вы получите собаку, которая на 50% приучена к горшку, а кому это нужно? Вот они — ваши два ключа к взлому дома …. [читать дальше]

    Общение вашего финского шпица
    Общение — это обучение вашего финского шпица вежливому общению с незнакомцами и другими животными.[подробнее]

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован.